"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
- "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
+ "/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches
In the last regexp, the forward slash C<'/'> is also backslashed,
because it is used to delimit the regexp. This can lead to LTS
(leaning toothpick syndrome), however, and it is often more readable
to change delimiters.
+ "/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read
The backslash character C<'\'> is a metacharacter itself and needs to
be backslashed:
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
-This regexp displays a common task: perform a a case-insensitive
+This regexp displays a common task: perform a case-insensitive
match. Perl provides away of avoiding all those brackets by simply
appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
can be rewritten as C</yes/i;>. The C<'i'> stands for
=over 4
=item *
+
\d is a digit and represents [0-9]
=item *
+
\s is a whitespace character and represents [\ \t\r\n\f]
=item *
+
\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
=item *
+
\D is a negated \d; it represents any character but a digit [^0-9]
=item *
+
\S is a negated \s; it represents any non-whitespace character [^\s]
=item *
+
\W is a negated \w; it represents any non-word character [^\w]
=item *
+
The period '.' matches any character but "\n"
=back
=over 4
=item *
+
no modifiers (//): Default behavior. C<'.'> matches any character
except C<"\n">. C<^> matches only at the beginning of the string and
C<$> matches only at the end or before a newline at the end.
=item *
+
s modifier (//s): Treat string as a single long line. C<'.'> matches
any character, even C<"\n">. C<^> matches only at the beginning of
the string and C<$> matches only at the end or before a newline at the
end.
=item *
+
m modifier (//m): Treat string as a set of multiple lines. C<'.'>
matches any character except C<"\n">. C<^> and C<$> are able to match
at the start or end of I<any> line within the string.
=item *
+
both s and m modifiers (//sm): Treat string as a single long line, but
detect multiple lines. C<'.'> matches any character, even
C<"\n">. C<^> and C<$>, however, are able to match at the start or end
The last example points out that character classes are like
alternations of characters. At a given character position, the first
-alternative that allows the regexp match to succeed wil be the one
+alternative that allows the regexp match to succeed will be the one
that matches.
=head2 Grouping things and hierarchical matching
regexp. For instance, suppose we want to search for housecats or
housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
inefficient because we had to type C<house> twice. It would be nice to
-have parts of the regexp be constant, like C<house>, and and some
+have parts of the regexp be constant, like C<house>, and some
parts have alternatives, like C<cat|keeper>.
The B<grouping> metacharacters C<()> solve this problem. Grouping
Alternations behave the same way in groups as out of them: at a given
string position, the leftmost alternative that allows the regexp to
-match is taken. So in the last example at tth first string position,
+match is taken. So in the last example at the first string position,
C<"20"> matches the second alternative, but there is nothing left over
to match the next two digits C<\d\d>. So perl moves on to the next
alternative, which is the null alternative and that works, since
=over 4
-=item 0 Start with the first letter in the string 'a'.
+=item 0
-=item 1 Try the first alternative in the first group 'abd'.
+Start with the first letter in the string 'a'.
-=item 2 Match 'a' followed by 'b'. So far so good.
+=item 1
-=item 3 'd' in the regexp doesn't match 'c' in the string - a dead
+Try the first alternative in the first group 'abd'.
+
+=item 2
+
+Match 'a' followed by 'b'. So far so good.
+
+=item 3
+
+'d' in the regexp doesn't match 'c' in the string - a dead
end. So backtrack two characters and pick the second alternative in
the first group 'abc'.
-=item 4 Match 'a' followed by 'b' followed by 'c'. We are on a roll
+=item 4
+
+Match 'a' followed by 'b' followed by 'c'. We are on a roll
and have satisfied the first group. Set $1 to 'abc'.
-=item 5 Move on to the second group and pick the first alternative
+=item 5
+
+Move on to the second group and pick the first alternative
'df'.
-=item 6 Match the 'd'.
+=item 6
+
+Match the 'd'.
+
+=item 7
-=item 7 'f' in the regexp doesn't match 'e' in the string, so a dead
+'f' in the regexp doesn't match 'e' in the string, so a dead
end. Backtrack one character and pick the second alternative in the
second group 'd'.
-=item 8 'd' matches. The second grouping is satisfied, so set $2 to
+=item 8
+
+'d' matches. The second grouping is satisfied, so set $2 to
'd'.
-=item 9 We are at the end of the regexp, so we are done! We have
+=item 9
+
+We are at the end of the regexp, so we are done! We have
matched 'abcd' out of the string "abcde".
=back
position of the string 'a'. If there were no matches at the first
position, perl would move to the second character position 'b' and
attempt the match all over again. Only when all possible paths at all
-possible character positions have been exhausted does perl give give
+possible character positions have been exhausted does perl give
up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
Even with all this work, regexp matching happens remarkably fast. To
used just as ordinary variables:
# extract hours, minutes, seconds
- $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
- $hours = $1;
- $minutes = $2;
- $seconds = $3;
+ if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
+ $hours = $1;
+ $minutes = $2;
+ $seconds = $3;
+ }
Now, we know that in scalar context,
S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
/(ab(cd|ef)((gi)|j))/;
1 2 34
-so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
-For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
-... that got assigned.
+so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For
+convenience, perl sets C<$+> to the string held by the highest numbered
+C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the
+value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>,
+C<$2>, ... associated with the rightmost closing parenthesis used in the
+match).
Closely associated with the matching variables C<$1>, C<$2>, ... are
the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
=over 4
-=item * C<a?> = match 'a' 1 or 0 times
+=item *
+
+C<a?> = match 'a' 1 or 0 times
+
+=item *
+
+C<a*> = match 'a' 0 or more times, i.e., any number of times
-=item * C<a*> = match 'a' 0 or more times, i.e., any number of times
+=item *
-=item * C<a+> = match 'a' 1 or more times, i.e., at least once
+C<a+> = match 'a' 1 or more times, i.e., at least once
-=item * C<a{n,m}> = match at least C<n> times, but not more than C<m>
+=item *
+
+C<a{n,m}> = match at least C<n> times, but not more than C<m>
times.
-=item * C<a{n,}> = match at least C<n> or more times
+=item *
+
+C<a{n,}> = match at least C<n> or more times
+
+=item *
-=item * C<a{n}> = match exactly C<n> times
+C<a{n}> = match exactly C<n> times
=back
=over 4
=item *
+
Principle 0: Taken as a whole, any regexp will be matched at the
earliest possible position in the string.
=item *
+
Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
that allows a match for the whole regexp will be the one used.
=item *
+
Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
C<{n,m}> will in general match as much of the string as possible while
still allowing the whole regexp to match.
=item *
+
Principle 3: If there are two or more elements in a regexp, the
leftmost greedy quantifier, if any, will match as much of the string
as possible while still allowing the whole regexp to match. The next
=over 4
-=item * C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
+=item *
+
+C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
+
+=item *
-=item * C<a*?> = match 'a' 0 or more times, i.e., any number of times,
+C<a*?> = match 'a' 0 or more times, i.e., any number of times,
but as few times as possible
-=item * C<a+?> = match 'a' 1 or more times, i.e., at least once, but
+=item *
+
+C<a+?> = match 'a' 1 or more times, i.e., at least once, but
as few times as possible
-=item * C<a{n,m}?> = match at least C<n> times, not more than C<m>
+=item *
+
+C<a{n,m}?> = match at least C<n> times, not more than C<m>
times, as few times as possible
-=item * C<a{n,}?> = match at least C<n> times, but as few times as
+=item *
+
+C<a{n,}?> = match at least C<n> times, but as few times as
possible
-=item * C<a{n}?> = match exactly C<n> times. Because we match exactly
+=item *
+
+C<a{n}?> = match exactly C<n> times. Because we match exactly
C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
notational consistency.
=over 4
=item *
+
Principle 3: If there are two or more elements in a regexp, the
leftmost greedy (non-greedy) quantifier, if any, will match as much
(little) of the string as possible while still allowing the whole
=over 4
-=item 0 Start with the first letter in the string 't'.
+=item 0
+
+Start with the first letter in the string 't'.
-=item 1 The first quantifier '.*' starts out by matching the whole
+=item 1
+
+The first quantifier '.*' starts out by matching the whole
string 'the cat in the hat'.
-=item 2 'a' in the regexp element 'at' doesn't match the end of the
+=item 2
+
+'a' in the regexp element 'at' doesn't match the end of the
string. Backtrack one character.
-=item 3 'a' in the regexp element 'at' still doesn't match the last
+=item 3
+
+'a' in the regexp element 'at' still doesn't match the last
letter of the string 't', so backtrack one more character.
-=item 4 Now we can match the 'a' and the 't'.
+=item 4
+
+Now we can match the 'a' and the 't'.
+
+=item 5
-=item 5 Move on to the third element '.*'. Since we are at the end of
+Move on to the third element '.*'. Since we are at the end of
the string and '.*' can match 0 times, assign it the empty string.
-=item 6 We are done!
+=item 6
+
+We are done!
=back
=over 4
-=item * specifying the task in detail,
+=item *
-=item * breaking down the problem into smaller parts,
+specifying the task in detail,
-=item * translating the small parts into regexps,
+=item *
-=item * combining the regexps,
+breaking down the problem into smaller parts,
+
+=item *
-=item * and optimizing the final combined regexp.
+translating the small parts into regexps,
+
+=item *
+
+combining the regexps,
+
+=item *
+
+and optimizing the final combined regexp.
=back
"dogbert =~ //; # this matches the 'd' regexp used before
The final two modifiers C<//g> and C<//c> concern multiple matches.
-The modifier C<//g> stands for global matching and allows the the
+The modifier C<//g> stands for global matching and allows the
matching operator to match within a string as many times as possible.
In scalar context, successive invocations against a string will have
`C<//g> jump from match to match, keeping track of position in the
The combination of C<//g> and C<\G> allows us to process the string a
bit at a time and use arbitrary Perl logic to decide what to do next.
+Currently, the C<\G> anchor is only fully supported when used to anchor
+to the start of the pattern.
C<\G> is also invaluable in processing fixed length records with
regexps. Suppose we have a snippet of coding region DNA, encoded as
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
-doesn't work; it may match an C<TGA>, but there is no guarantee that
+doesn't work; it may match a C<TGA>, but there is no guarantee that
the match is aligned with codon boundaries, e.g., the substring
S<C<GTT GAA> > gives a match. A better solution is
matching regular expressions is analogous to a walk in the woods, then
the tools discussed in Part 1 are analogous to topo maps and a
compass, basic tools we use all the time. Most of the tools in part 2
-are are analogous to flare guns and satellite phones. They aren't used
+are analogous to flare guns and satellite phones. They aren't used
too often on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes esoteric
than C<chr(127)> may be represented using the C<\x{hex}> notation,
with C<hex> a hexadecimal integer:
- use utf8; # We will be doing Unicode processing
/\x{263a}/; # match a Unicode smiley face :)
Unicode characters in the range of 128-255 use two hexadecimal digits
with braces: C<\x{ab}>. Note that this is different than C<\xab>,
-which is just a hexadecimal byte with no Unicode
-significance.
+which is just a hexadecimal byte with no Unicode significance.
+
+B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use
+utf8> to use any Unicode features. This is no more the case: for
+almost all Unicode processing, the explicit C<utf8> pragma is not
+needed. (The only case where it matters is if your Perl script is in
+Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
Figuring out the hexadecimal sequence of a Unicode character you want
or deciphering someone else's hexadecimal Unicode regexp is about as
represent or match the astrological sign for the planet Mercury, we
could use
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
One can also use short names or restrict names to a certain alphabet:
- use utf8; # We will be doing Unicode processing
-
use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
print "\N{sigma} is Greek sigma\n";
A list of full names is found in the file Names.txt in the
-lib/perl5/5.6.0/unicode directory.
+lib/perl5/5.X.X/unicore directory.
The answer to requirement 2), as of 5.6.0, is that if a regexp
contains Unicode characters, the string is searched as a sequence of
escape sequence. C<\C> is a character class akin to C<.> except that
it matches I<any> byte 0-255. So
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "a";
$x =~ /\C/; # matches 'a', eats one byte
The last regexp matches, but is dangerous because the string
I<character> position is no longer synchronized to the string I<byte>
position. This generates the warning 'Malformed UTF-8
-character'. C<\C> is best used for matching the binary data in strings
+character'. The C<\C> is best used for matching the binary data in strings
with binary data intermixed with Unicode characters.
Let us now discuss the rest of the character classes. Just as with
C<\p{name}> class. For example, to match lower and uppercase
characters,
- use utf8; # We will be doing Unicode processing
use charnames ":full"; # use named chars with Unicode full names
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
-If a C<name> is just one letter, the braces can be dropped. For
-instance, C<\pM> is the character class of Unicode 'marks'. Here is
-the association between some Perl named classes and the traditional
-Unicode classes:
+Here is the association between some Perl named classes and the
+traditional Unicode classes:
- Perl class name Unicode class name
+ Perl class name Unicode class name or regular expression
- IsAlpha Lu, Ll, or Lo
- IsAlnum Lu, Ll, Lo, or Nd
- IsASCII $code le 127
- IsCntrl C
+ IsAlpha /^[LM]/
+ IsAlnum /^[LMN]/
+ IsASCII $code <= 127
+ IsCntrl /^C/
+ IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
IsDigit Nd
- IsGraph [^C] and $code ne "0020"
+ IsGraph /^([LMNPS]|Co)/
IsLower Ll
- IsPrint [^C]
- IsPunct P
- IsSpace Z, or ($code lt "0020" and chr(hex $code) is a \s)
- IsUpper Lu
- IsWord Lu, Ll, Lo, Nd or $code eq "005F"
+ IsPrint /^([LMNPS]|Co|Zs)/
+ IsPunct /^P/
+ IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
+ IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
+ IsUpper /^L[ut]/
+ IsWord /^[LMN]/ || $code eq "005F"
IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
-For a full list of Perl class names, consult the mktables.PL program
-in the lib/perl5/5.6.0/unicode directory.
+You can also use the official Unicode class names with the C<\p> and
+C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
+letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
+letter, the braces can be dropped. For instance, C<\pM> is the
+character class of Unicode 'marks', for example accent marks.
+For the full list see L<perlunicode>.
+
+The Unicode has also been separated into various sets of charaters
+which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in),
+for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>.
+For the full list see L<perlunicode>.
C<\X> is an abbreviation for a character class sequence that includes
the Unicode 'combining character sequences'. A 'combining character
atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
i.e., a non-mark followed by one or more marks.
+For the full and latest information about Unicode see the latest
+Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
+
As if all those classes weren't enough, Perl also defines POSIX style
character classes. These have the form C<[:name:]>, with C<name> the
name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
character classes. To negate a POSIX class, put a C<^> in front of
the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
-be used just like C<\d>, both inside and outside of character classes:
+be used just like C<\d>, with the exception that POSIX character
+classes can only be used inside of a character class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
- /^=item\s[:digit:]/; # match '=item',
+ /^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
- use utf8;
use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
+The C<\C> is unsupported in lookbehind, because the already
+treacherous definition of C<\C> would become even more so
+when going backwards.
+
=head2 Using independent subexpressions to prevent backtracking
The last few extended patterns in this tutorial are experimental as of
The independent subexpression C<< (?>a*) >> doesn't care about the rest
of the regexp, so it sees an C<a> and grabs it. Then the rest of the
regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
-is no backtracking and and the independent subexpression does not give
+is no backtracking and the independent subexpression does not give
up its C<a>. Thus the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
parentheses and the second alternative C<\([^()]*\)> matching a
substring delimited by parentheses. The problem with this regexp is
that it is pathological: it has nested indeterminate quantifiers
- of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
+of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
like this could take an exponentially long time to execute if there
was no match possible. To prevent the exponential blowup, we need to
prevent useless backtracking at some point. This can be done by
Normally, regexps are a part of Perl expressions.
S<B<Code evaluation> > expressions turn that around by allowing
-arbitrary Perl code to be a part of of a regexp. A code evaluation
+arbitrary Perl code to be a part of a regexp. A code evaluation
expression is denoted C<(?{code})>, with C<code> a string of Perl
statements.
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'
+
+Pay careful attention to the next example:
+
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
+ # but why not?
+
+At first glance, you'd think that it shouldn't print, because obviously
+the C<ddd> isn't going to match the target string. But look at this
+example:
+
+ $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
+ # but _does_ print
+
+Hmm. What happened here? If you've been following along, you know that
+the above pattern should be effectively the same as the last one --
+enclosing the d in a character class isn't going to change what it
+matches. So why does the first not print while the second one does?
+
+The answer lies in the optimizations the REx engine makes. In the first
+case, all the engine sees are plain old characters (aside from the
+C<?{}> construct). It's smart enough to realize that the string 'ddd'
+doesn't occur in our target string before actually running the pattern
+through. But in the second case, we've tricked it into thinking that our
+pattern is more complicated than it is. It takes a look, sees our
+character class, and decides that it will have to actually run the
+pattern to determine whether or not it matches, and in the process of
+running it hits the print statement before it discovers that we don't
+have a match.
+
+To take a closer look at how the engine does optimizations, see the
+section L<"Pragmas and debugging"> below.
+
+More fun with C<?{}>:
+
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,