about 98% of your needs. The second part of the tutorial is for those
comfortable with the basics and hungry for more power tools. It
discusses the more advanced regular expression operators and
-introduces the latest cutting edge innovations in 5.6.0.
+introduces the latest cutting-edge innovations.
A note: to save time, 'regular expression' is often abbreviated as
regexp or regex. Regexp is a more natural abbreviation than regex, but
"Hello World" =~ /World/; # matches
-What is this perl statement all about? C<"Hello World"> is a simple
-double quoted string. C<World> is the regular expression and the
-C<//> enclosing C</World/> tells perl to search a string for a match.
+What is this Perl statement all about? C<"Hello World"> is a simple
+double-quoted string. C<World> is the regular expression and the
+C<//> enclosing C</World/> tells Perl to search a string for a match.
The operator C<=~> associates the string with the regexp match and
produces a true value if the regexp matched, or false if the regexp
did not match. In our case, C<World> matches the second word in
}
There are useful variations on this theme. The sense of the match can
-be reversed by using C<!~> operator:
+be reversed by using the C<!~> operator:
if ("Hello World" !~ /World/) {
print "It doesn't match\n";
# '/' becomes an ordinary char
C</World/>, C<m!World!>, and C<m{World}> all represent the
-same thing. When, e.g., C<""> is used as a delimiter, the forward
-slash C<'/'> becomes an ordinary character and can be used in a regexp
+same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward
+slash C<'/'> becomes an ordinary character and can be used in this regexp
without trouble.
Let's consider how different regexps would match C<"Hello World">:
The first regexp C<world> doesn't match because regexps are
case-sensitive. The second regexp matches because the substring
-S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space
+S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space
character ' ' is treated like any other character in a regexp and is
needed to match in this case. The lack of a space character is the
reason the third regexp C<'oW'> doesn't match. The fourth regexp
regexps must match a part of the string I<exactly> in order for the
statement to be true.
-If a regexp matches in more than one place in the string, perl will
+If a regexp matches in more than one place in the string, Perl will
always match at the earliest possible point in the string:
"Hello World" =~ /o/; # matches 'o' in 'Hello'
With respect to character matching, there are a few more points you
need to know about. First of all, not all characters can be used 'as
-is' in a match. Some characters, called B<metacharacters>, are reserved
+is' in a match. Some characters, called I<metacharacters>, are reserved
for use in regexp notation. The metacharacters are
{}[]()^$.|*+?\
"2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
"The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
"The interval is [0,1)." =~ /\[0,1\)\./ # matches
- "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/; # matches
+ "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
In the last regexp, the forward slash C<'/'> is also backslashed,
because it is used to delimit the regexp. This can lead to LTS
(leaning toothpick syndrome), however, and it is often more readable
to change delimiters.
+ "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
The backslash character C<'\'> is a metacharacter itself and needs to
be backslashed:
In addition to the metacharacters, there are some ASCII characters
which don't have printable character equivalents and are instead
-represented by B<escape sequences>. Common examples are C<\t> for a
+represented by I<escape sequences>. Common examples are C<\t> for a
tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
-bell. If your string is better thought of as a sequence of arbitrary
+bell (or alert). If your string is better thought of as a sequence of arbitrary
bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
sequence, e.g., C<\x1B> may be a more natural representation for your
bytes. Here are some examples of escapes:
"1000\t2000" =~ m(0\t2) # matches
"1000\n2000" =~ /0\n20/ # matches
"1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
- "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
+ "cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
+ # to spell cat
If you've been around Perl a while, all this talk of escape sequences
may seem familiar. Similar escape sequences are used in double-quoted
This program is easy to understand. C<#!/usr/bin/perl> is the standard
way to invoke a perl program from the shell.
-S<C<$regexp = shift;> > saves the first command line argument as the
+S<C<$regexp = shift;>> saves the first command line argument as the
regexp to be used, leaving the rest of the command line arguments to
-be treated as files. S<C<< while (<>) >> > loops over all the lines in
-all the files. For each line, S<C<print if /$regexp/;> > prints the
+be treated as files. S<C<< while (<>) >>> loops over all the lines in
+all the files. For each line, S<C<print if /$regexp/;>> prints the
line if the regexp matches the line. In this line, both C<print> and
C</$regexp/> use the default variable C<$_> implicitly.
With all of the regexps above, if the regexp matched anywhere in the
string, it was considered a match. Sometimes, however, we'd like to
specify I<where> in the string the regexp should try to match. To do
-this, we would use the
B<anchor> metacharacters C<^> and C<$>. The
+this, we would use the
I<anchor> metacharacters C<^> and C<$>. The
anchor C<^> means match at the beginning of the string and the anchor
C<$> means match at the end of the string, or before a newline at the
end of the string. Here is how they are used:
"bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just as easily
-use the string equivalence S<C<$string eq 'bert'> > and it would be
+use the string comparison S<C<$string eq 'bert'>> and it would be
more efficient. The C<^...$> regexp really becomes useful when we
add in the more powerful regexp tools below.
regexps above, we've only scratched the surface of regular expression
technology. In this and subsequent sections we will introduce regexp
concepts (and associated metacharacter notations) that will allow a
-regexp to not just represent a single character sequence, but a I<whole
+regexp to represent not just a single character sequence, but a I<whole
class> of them.
-One such concept is that of a B<character class>. A character class
+One such concept is that of a I<character class>. A character class
allows a set of possible characters, rather than just a single
-character, to match at a particular point in a regexp. Character
-classes are denoted by brackets C<[...]>, with the set of characters
+character, to match at a particular point in a regexp. You can define
+your own custom character classes. These
+are denoted by brackets C<[...]>, with the set of characters
to be possibly matched inside. Here are some examples:
/cat/; # matches 'cat'
/[yY][eE][sS]/; # match 'yes' in a case-insensitive way
# 'yes', 'Yes', 'YES', etc.
-This regexp displays a common task: perform a a case-insensitive
-match. Perl provides away of avoiding all those brackets by simply
+This regexp displays a common task: perform a case-insensitive
+match. Perl provides a way of avoiding all those brackets by simply
appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
can be rewritten as C</yes/i;>. The C<'i'> stands for
-case-insensitive and is an example of a B<modifier> of the matching
+case-insensitive and is an example of a I<modifier> of the matching
operation. We will meet other modifiers later in the tutorial.
We saw in the section above that there were ordinary characters, which
backslash C<\> to represent themselves. The same is true in a
character class, but the sets of ordinary and special characters
inside a character class are different than those outside a character
-class. The special characters for a character class are C<-]\^$>. C<]>
-is special because it denotes the end of a character class. C<$> is
+class. The special characters for a character class are C<-]\^$> (and
+the pattern delimiter, whatever it is).
+C<]> is special because it denotes the end of a character class. C<$> is
special because it denotes a scalar variable. C<\> is special because
it is used in escape sequences, just like above. Here is how the
special characters C<]$\> are handled:
/[\$x]at/; # matches '$at' or 'xat'
/[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
-The last two are a little tricky. in C<[\$x]>, the backslash protects
+The last two are a little tricky. In C<[\$x]>, the backslash protects
the dollar sign, so the character class has two members C<$> and C<x>.
In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
variable and substituted in double quote fashion.
/[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
# 'baa', 'xaa', 'yaa', or 'zaa'
/[0-9a-fA-F]/; # matches a hexadecimal digit
- /[0-9a-zA-Z_]/; # matches an alphanumeric character,
- # like those in a perl variable name
+ /[0-9a-zA-Z_]/; # matches a "word" character,
+ # like those in a Perl variable name
If C<'-'> is the first or last character in a character class, it is
treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
all equivalent.
The special character C<^> in the first position of a character class
-denotes a B<negated character class>, which matches any character but
+denotes a I<negated character class>, which matches any character but
those in the brackets. Both C<[...]> and C<[^...]> must match a
character, or the match fails. Then
/[^0-9]/; # matches a non-numeric character
/[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
-Now, even C<[0-9]> can be a bother the write multiple times, so in the
+Now, even C<[0-9]> can be a bother to write multiple times, so in the
interest of saving keystrokes and making regexps more readable, Perl
-has several abbreviations for common character classes:
+has several abbreviations for common character classes, as shown below.
+Since the introduction of Unicode, unless the C<//a> modifier is in
+effect, these character classes match more than just a few characters in
+the ASCII range.
=over 4
=item *
-\d is a digit and represents [0-9]
+
+\d matches a digit, not just [0-9] but also digits from non-roman scripts
=item *
-\s is a whitespace character and represents [\ \t\r\n\f]
+
+\s matches a whitespace character, the set [\ \t\r\n\f] and others
=item *
-\w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_]
+
+\w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]
+but also digits and characters from non-roman scripts
=item *
-\D is a negated \d; it represents any character but a digit [^0-9]
+
+\D is a negated \d; it represents any other character than a digit, or [^\d]
=item *
+
\S is a negated \s; it represents any non-whitespace character [^\s]
=item *
+
\W is a negated \w; it represents any non-word character [^\w]
=item *
-The period '.' matches any character but "\n"
+
+The period '.' matches any character but "\n" (unless the modifier C<//s> is
+in effect, as explained below).
+
+=item *
+
+\N, like the period, matches any character but "\n", but it does so
+regardless of whether the modifier C<//s> is in effect.
=back
+The C<//a> modifier, available starting in Perl 5.14, is used to
+restrict the matches of \d, \s, and \w to just those in the ASCII range.
+It is useful to keep your program from being needlessly exposed to full
+Unicode (and its accompanying security considerations) when all you want
+is to process English-like text. (The "a" may be doubled, C<//aa>, to
+provide even more restrictions, preventing case-insensitive matching of
+ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign"
+would caselessly match a "k" or "K".)
+
The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
-of character classes. Here are some in use:
+of bracketed character classes. Here are some in use:
/\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
/[\d\s]/; # matches any digit or whitespace character
fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
C<[\W]>. Think DeMorgan's laws.
-An anchor useful in basic regexps is the S<B<word anchor> >
+In actuality, the period and C<\d\s\w\D\S\W> abbreviations are
+themselves types of character classes, so the ones surrounded by
+brackets are just one type of character class. When we need to make a
+distinction, we refer to them as "bracketed character classes."
+
+An anchor useful in basic regexps is the I<word anchor>
C<\b>. This matches a boundary between a word character and a non-word
character C<\w\W> or C<\W\w>:
every character? The reason is that often one is matching against
lines and would like to ignore the newline characters. For instance,
while the string C<"\n"> represents one line, we would like to think
-of as empty. Then
+of it as empty. Then
"" =~ /^$/; # matches
- "\n" =~ /^$/; # matches, "\n" is ignored
+ "\n" =~ /^$/; # matches, $ anchors before "\n"
"" =~ /./; # doesn't match; it needs a char
"" =~ /^.$/; # doesn't match; it needs a char
"\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
"a" =~ /^.$/; # matches
- "a\n" =~ /^.$/; # matches, ignores the "\n"
+ "a\n" =~ /^.$/; # matches, $ anchors before "\n"
This behavior is convenient, because we usually want to ignore
newlines when we count and match characters in a line. Sometimes,
=over 4
=item *
+
no modifiers (//): Default behavior. C<'.'> matches any character
except C<"\n">. C<^> matches only at the beginning of the string and
C<$> matches only at the end or before a newline at the end.
=item *
+
s modifier (//s): Treat string as a single long line. C<'.'> matches
any character, even C<"\n">. C<^> matches only at the beginning of
the string and C<$> matches only at the end or before a newline at the
end.
=item *
+
m modifier (//m): Treat string as a set of multiple lines. C<'.'>
matches any character except C<"\n">. C<^> and C<$> are able to match
at the start or end of I<any> line within the string.
=item *
+
both s and m modifiers (//sm): Treat string as a single long line, but
detect multiple lines. C<'.'> matches any character, even
C<"\n">. C<^> and C<$>, however, are able to match at the start or end
$x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
$x =~ /girl.Who/sm; # matches, "." matches "\n"
-Most of the time, the default behavior is what is want, but C<//s> and
+Most of the time, the default behavior is what is wanted, but C<//s> and
C<//m> are occasionally very useful. If C<//m> is being used, the start
-of the string can still be matched with C<\A> and the end of string
+of the string can still be matched with C<\A> and the end of the string
can still be matched with the anchors C<\Z> (matches both the end and
the newline before, like C<$>), and C<\z> (matches only the end):
=head2 Matching this or that
-Sometimes we would like to our regexp to be able to match different
+Sometimes we would like our regexp to be able to match different
possible words or character strings. This is accomplished by using
-the
B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
-form the regexp C<dog|cat>. As before, perl will try to match the
+the
I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
+form the regexp C<dog|cat>. As before, Perl will try to match the
regexp at the earliest possible point in the string. At each
-character position, perl will first try to match the first
-alternative, C<dog>. If C<dog> doesn't match, perl will then try the
+character position, Perl will first try to match the first
+alternative, C<dog>. If C<dog> doesn't match, Perl will then try the
next alternative, C<cat>. If C<cat> doesn't match either, then the
-match fails and perl moves to the next position in the string. Some
+match fails and Perl moves to the next position in the string. Some
examples:
"cats and dogs" =~ /cat|dog|bird/; # matches "cat"
The last example points out that character classes are like
alternations of characters. At a given character position, the first
-alternative that allows the regexp match to succeed wil be the one
+alternative that allows the regexp match to succeed will be the one
that matches.
=head2 Grouping things and hierarchical matching
Alternation allows a regexp to choose among alternatives, but by
-itself it unsatisfying. The reason is that each alternative is a whole
+itself it is unsatisfying. The reason is that each alternative is a whole
regexp, but sometime we want alternatives for just part of a
regexp. For instance, suppose we want to search for housecats or
housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
inefficient because we had to type C<house> twice. It would be nice to
-have parts of the regexp be constant, like C<house>, and and some
+have parts of the regexp be constant, like C<house>, and some
parts have alternatives, like C<cat|keeper>.
-The B<grouping> metacharacters C<()> solve this problem. Grouping
+The I<grouping> metacharacters C<()> solve this problem. Grouping
allows parts of a regexp to be treated as a single unit. Parts of a
regexp are grouped by enclosing them in parentheses. Thus we could solve
the C<housecat|housekeeper> by forming the regexp as
Alternations behave the same way in groups as out of them: at a given
string position, the leftmost alternative that allows the regexp to
-match is taken. So in the last example at tth first string position,
+match is taken. So in the last example at the first string position,
C<"20"> matches the second alternative, but there is nothing left over
-to match the next two digits C<\d\d>. So perl moves on to the next
+to match the next two digits C<\d\d>. So Perl moves on to the next
alternative, which is the null alternative and that works, since
C<"20"> is two digits.
The process of trying one alternative, seeing if it matches, and
-moving on to the next alternative if it doesn't, is called
-B<backtracking>. The term 'backtracking' comes from the idea that
+moving on to the next alternative, while going back in the string
+from where the previous alternative was tried, if it doesn't, is called
+I<backtracking>. The term 'backtracking' comes from the idea that
matching a regexp is like a walk in the woods. Successfully matching
a regexp is like arriving at a destination. There are many possible
trailheads, one for each string position, and each one is tried in
other trails. You are persistent, and only if you have tried all the
trails from all the trailheads and not arrived at your destination, do
you declare failure. To be concrete, here is a step-by-step analysis
-of what perl does when it tries to match the regexp
+of what Perl does when it tries to match the regexp
"abcde" =~ /(abd|abc)(df|d|de)/;
=over 4
-=item 0 Start with the first letter in the string 'a'.
+=item Z<>0
-=item 1 Try the first alternative in the first group 'abd'.
+Start with the first letter in the string 'a'.
-=item 2 Match 'a' followed by 'b'. So far so good.
+=item Z<>1
-=item 3 'd' in the regexp doesn't match 'c' in the string - a dead
+Try the first alternative in the first group 'abd'.
+
+=item Z<>2
+
+Match 'a' followed by 'b'. So far so good.
+
+=item Z<>3
+
+'d' in the regexp doesn't match 'c' in the string - a dead
end. So backtrack two characters and pick the second alternative in
the first group 'abc'.
-=item 4 Match 'a' followed by 'b' followed by 'c'. We are on a roll
+=item Z<>4
+
+Match 'a' followed by 'b' followed by 'c'. We are on a roll
and have satisfied the first group. Set $1 to 'abc'.
-=item 5 Move on to the second group and pick the first alternative
+=item Z<>5
+
+Move on to the second group and pick the first alternative
'df'.
-=item 6 Match the 'd'.
+=item Z<>6
+
+Match the 'd'.
+
+=item Z<>7
-=item 7 'f' in the regexp doesn't match 'e' in the string, so a dead
+'f' in the regexp doesn't match 'e' in the string, so a dead
end. Backtrack one character and pick the second alternative in the
second group 'd'.
-=item 8 'd' matches. The second grouping is satisfied, so set $2 to
+=item Z<>8
+
+'d' matches. The second grouping is satisfied, so set $2 to
'd'.
-=item 9 We are at the end of the regexp, so we are done! We have
+=item Z<>9
+
+We are at the end of the regexp, so we are done! We have
matched 'abcd' out of the string "abcde".
=back
stopped before we got to it - at a given character position, leftmost
wins. Second, we were able to get a match at the first character
position of the string 'a'. If there were no matches at the first
-position, perl would move to the second character position 'b' and
+position, Perl would move to the second character position 'b' and
attempt the match all over again. Only when all possible paths at all
-possible character positions have been exhausted does perl give give
-up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false.
+possible character positions have been exhausted does Perl give
+up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false.
Even with all this work, regexp matching happens remarkably fast. To
-speed things up, during compilation stage, perl compiles the regexp
-into a compact sequence of opcodes that can often fit inside a
-processor cache. When the code is executed, these opcodes can then run
-at full throttle and search very quickly.
+speed things up, Perl compiles the regexp into a compact sequence of
+opcodes that can often fit inside a processor cache. When the code is
+executed, these opcodes can then run at full throttle and search very
+quickly.
=head2 Extracting matches
used just as ordinary variables:
# extract hours, minutes, seconds
- $time =~ /(\d\d):(\d\d):(\d\d)/; # match hh:mm:ss format
- $hours = $1;
- $minutes = $2;
- $seconds = $3;
+ if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
+ $hours = $1;
+ $minutes = $2;
+ $seconds = $3;
+ }
Now, we know that in scalar context,
-S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false
+S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false
value. In list context, however, it returns the list of matched values
C<($1,$2,$3)>. So we could write the code more compactly as
If the groupings in a regexp are nested, C<$1> gets the group with the
leftmost opening parenthesis, C<$2> the next opening parenthesis,
-etc. For example, here is a complex regexp and the matching variables
-indicated below it:
+etc. Here is a regexp with nested groups:
/(ab(cd|ef)((gi)|j))/;
1 2 34
-so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'.
-For convenience, perl sets C<$+> to the highest numbered C<$1>, C<$2>,
-... that got assigned.
+If this regexp matches, C<$1> contains a string starting with
+C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either
+C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>,
+or it remains undefined.
+
+For convenience, Perl sets C<$+> to the string held by the highest numbered
+C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the
+value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>,
+C<$2>,... associated with the rightmost closing parenthesis used in the
+match).
+
+
+=head2 Backreferences
Closely associated with the matching variables C<$1>, C<$2>, ... are
-the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply
+the I<backreferences> C<\g1>, C<\g2>,... Backreferences are simply
matching variables that can be used I<inside> a regexp. This is a
-really nice feature - what matches later in a regexp can depend on
+really nice feature; what matches later in a regexp is made to depend on
what matched earlier in the regexp. Suppose we wanted to look
-for doubled words in text, like 'the the'. The following regexp finds
+for doubled words in a text, like 'the the'. The following regexp finds
all 3-letter doubles with a space in between:
- /(\w\w\w)\s\1/;
+ /\b(\w\w\w)\s\g1\b/;
-The grouping assigns a value to \1, so that the same 3 letter sequence
-is used for both parts. Here are some words with repeated parts:
+The grouping assigns a value to \g1, so that the same 3-letter sequence
+is used for both parts.
- % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
+A similar task is to find words consisting of two identical parts:
+
+ % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
beriberi
booboo
coco
papa
The regexp has a single grouping which considers 4-letter
-combinations, then 3-letter combinations, etc. and uses C<\1> to look for
-a repeat. Although C<$1> and C<\1> represent the same thing, care should be
-taken to use matched variables C<$1>, C<$2>, ... only outside a regexp
-and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing
-so may lead to surprising and/or undefined results.
-
-In addition to what was matched, Perl 5.6.0 also provides the
-positions of what was matched with the C<@-> and C<@+>
+combinations, then 3-letter combinations, etc., and uses C<\g1> to look for
+a repeat. Although C<$1> and C<\g1> represent the same thing, care should be
+taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp
+and backreferences C<\g1>, C<\g2>,... only I<inside> a regexp; not doing
+so may lead to surprising and unsatisfactory results.
+
+
+=head2 Relative backreferences
+
+Counting the opening parentheses to get the correct number for a
+backreference is error-prone as soon as there is more than one
+capturing group. A more convenient technique became available
+with Perl 5.10: relative backreferences. To refer to the immediately
+preceding capture group one now may write C<\g{-1}>, the next but
+last is available via C<\g{-2}>, and so on.
+
+Another good reason in addition to readability and maintainability
+for using relative backreferences is illustrated by the following example,
+where a simple pattern for matching peculiar strings is used:
+
+ $a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.
+
+Now that we have this pattern stored as a handy string, we might feel
+tempted to use it as a part of some other pattern:
+
+ $line = "code=e99e";
+ if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
+ print "$1 is valid\n";
+ } else {
+ print "bad line: '$line'\n";
+ }
+
+But this doesn't match, at least not the way one might expect. Only
+after inserting the interpolated C<$a99a> and looking at the resulting
+full text of the regexp is it obvious that the backreferences have
+backfired. The subexpression C<(\w+)> has snatched number 1 and
+demoted the groups in C<$a99a> by one rank. This can be avoided by
+using relative backreferences:
+
+ $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
+
+
+=head2 Named backreferences
+
+Perl 5.10 also introduced named capture groups and named backreferences.
+To attach a name to a capturing group, you write either
+C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may
+then be written as C<\g{name}>. It is permissible to attach the
+same name to more than one group, but then only the leftmost one of the
+eponymous set can be referenced. Outside of the pattern a named
+capture group is accessible through the C<%+> hash.
+
+Assuming that we have to match calendar dates which may be given in one
+of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
+three suitable patterns where we use 'd', 'm' and 'y' respectively as the
+names of the groups capturing the pertaining components of a date. The
+matching operation combines the three patterns as alternatives:
+
+ $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
+ $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
+ $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
+ for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
+ if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
+ print "day=$+{d} month=$+{m} year=$+{y}\n";
+ }
+ }
+
+If any of the alternatives matches, the hash C<%+> is bound to contain the
+three key-value pairs.
+
+
+=head2 Alternative capture group numbering
+
+Yet another capturing group numbering technique (also as from Perl 5.10)
+deals with the problem of referring to groups within a set of alternatives.
+Consider a pattern for matching a time of the day, civil or military style:
+
+ if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
+ # process hour and minute
+ }
+
+Processing the results requires an additional if statement to determine
+whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would
+be easier if we could use group numbers 1 and 2 in second alternative as
+well, and this is exactly what the parenthesized construct C<(?|...)>,
+set around an alternative achieves. Here is an extended version of the
+previous pattern:
+
+ if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
+ print "hour=$1 minute=$2 zone=$3\n";
+ }
+
+Within the alternative numbering group, group numbers start at the same
+position for each alternative. After the group, numbering continues
+with one higher than the maximum reached across all the alternatives.
+
+=head2 Position information
+
+In addition to what was matched, Perl also provides the
+positions of what was matched as contents of the C<@-> and C<@+>
arrays. C<$-[0]> is the position of the start of the entire match and
C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
position of the start of the C<$n> match and C<$+[n]> is the position
$x = "Mmm...donut, thought Homer";
$x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
- foreach $expr (1..$#-) {
- print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
+ foreach $exp (1..$#-) {
+ print "Match $exp: '${$exp}' at position ($-[$exp],$+[$exp])\n";
}
prints
Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still possible to
-find out what exactly matched in a string. If you use them, perl
+find out what exactly matched in a string. If you use them, Perl
will set C<$`> to the part of the string before the match, will set C<$&>
to the part of the string that matched, and will set C<$'> to the part
of the string after the match. An example:
$x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
$x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
-In the second match, S<C<$` = ''> > because the regexp matched at the
-first character position in the string and stopped, it never saw the
-second 'the'. It is important to note that using C<$`> and C<$'>
-slows down regexp matching quite a bit, and C< $& > slows it down to a
+In the second match, C<$`> equals C<''> because the regexp matched at the
+first character position in the string and stopped; it never saw the
+second 'the'.
+
+If your code is to run on Perl versions earlier than
+5.20, it is worthwhile to note that using C<$`> and C<$'>
+slows down regexp matching quite a bit, while C<$&> slows it down to a
lesser extent, because if they are used in one regexp in a program,
-they are generated for <all> regexps in the program. So if raw
+they are generated for
I<all> regexps in the program. So if raw
performance is a goal of your application, they should be avoided.
-If you need them, use C<@-> and C<@+> instead:
+If you need to extract the corresponding substrings, use C<@-> and
+C<@+> instead:
$` is the same as substr( $x, 0, $-[0] )
$& is the same as substr( $x, $-[0], $+[0]-$-[0] )
$' is the same as substr( $x, $+[0] )
+As of Perl 5.10, the C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}>
+variables may be used. These are only set if the C</p> modifier is
+present. Consequently they do not penalize the rest of the program. In
+Perl 5.20, C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}> are available
+whether the C</p> has been used or not (the modifier is ignored), and
+C<$`>, C<$'> and C<$&> do not cause any speed difference.
+
+=head2 Non-capturing groupings
+
+A group that is required to bundle a set of alternatives may or may not be
+useful as a capturing group. If it isn't, it just creates a superfluous
+addition to the set of available capture group values, inside as well as
+outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>,
+still allow the regexp to be treated as a single unit, but don't establish
+a capturing group at the same time. Both capturing and non-capturing
+groupings are allowed to co-exist in the same regexp. Because there is
+no extraction, non-capturing groupings are faster than capturing
+groupings. Non-capturing groupings are also handy for choosing exactly
+which parts of a regexp are to be extracted to matching variables:
+
+ # match a number, $1-$4 are set, but we only want $1
+ /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
+
+ # match a number faster , only $1 is set
+ /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
+
+ # match a number, get $1 = whole number, $2 = exponent
+ /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
+
+Non-capturing groupings are also useful for removing nuisance
+elements gathered from a split operation where parentheses are
+required for some reason:
+
+ $x = '12aba34ba5';
+ @num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
+ @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
+
+In Perl 5.22 and later, all groups within a regexp can be set to
+non-capturing by using the new C</n> flag:
+
+ "hello" =~ /(hi|hello)/n; # $1 is not set!
+
+See L<perlre/"n"> for more information.
+
=head2 Matching repetitions
The examples in the previous section display an annoying weakness. We
-were only matching 3-letter words, or syllables of 4 letters or
-less. We'd like to be able to match words or syllables of any length,
-without writing out tedious alternatives like
+were only matching 3-letter words, or chunks of words of 4 letters or
+less. We'd like to be able to match words or, more generally, strings
+of any length, without writing out tedious alternatives like
C<\w\w\w\w|\w\w\w|\w\w|\w>.
-This is exactly the problem the B<quantifier> metacharacters C<?>,
-C<*>, C<+>, and C<{}> were created for. They allow us to determine the
-number of repeats of a portion of a regexp we consider to be a
+This is exactly the problem the I<quantifier> metacharacters C<?>,
+C<*>, C<+>, and C<{}> were created for. They allow us to delimit the
+number of repeats for a portion of a regexp we consider to be a
match. Quantifiers are put immediately after the character, character
class, or grouping that we want to specify. They have the following
meanings:
=over 4
-=item * C<a?> = match 'a' 1 or 0 times
+=item *
+
+C<a?> means: match 'a' 1 or 0 times
-=item * C<a*> = match 'a' 0 or more times, i.e., any number of times
+=item *
+
+C<a*> means: match 'a' 0 or more times, i.e., any number of times
+
+=item *
-=item * C<a+> = match 'a' 1 or more times, i.e., at least once
+C<a+> means: match 'a' 1 or more times, i.e., at least once
-=item * C<a{n,m}> = match at least C<n> times, but not more than C<m>
+=item *
+
+C<a{n,m}> means: match at least C<n> times, but not more than C<m>
times.
-=item * C<a{n,}> = match at least C<n> or more times
+=item *
+
+C<a{n,}> means: match at least C<n> or more times
-=item * C<a{n}> = match exactly C<n> times
+=item *
+
+C<a{n}> means: match exactly C<n> times
=back
Here are some examples:
- /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and
+ /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
# any number of digits
- /(\w+)\s+\1/; # match doubled words of arbitrary length
+ /(\w+)\s+\g1/; # match doubled words of arbitrary length
/y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
- $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
- # than 4 digits
- $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
- $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
- # this produces $1 and the other does not.
-
- % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
+ $year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
+ # than 4 digits
+ $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
+ $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
+ # However, this captures the last two
+ # digits in $1 and the other does not.
+
+ % simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
beriberi
booboo
coco
murmur
papa
-For all of these quantifiers, perl will try to match as much of the
+For all of these quantifiers, Perl will try to match as much of the
string as possible, while still allowing the regexp to succeed. Thus
-with C</a?.../>,
perl will first try to match the regexp with the C<a>
-present; if that fails, perl will try to match the regexp without the
+with C</a?.../>,
Perl will first try to match the regexp with the C<a>
+present; if that fails, Perl will try to match the regexp without the
C<a> present. For the quantifier C<*>, we get the following:
$x = "the cat in the hat";
$x =~ /^(.*)(at)(.*)$/; # matches,
# $1 = 'the cat in the h'
# $2 = 'at'
- # $3 = '' (0 matches)
+ # $3 = '' (0 characters match)
-One might initially guess that
perl would find the C<at> in C<cat> and
+One might initially guess that
Perl would find the C<at> in C<cat> and
stop there, but that wouldn't give the longest possible string to the
first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
much of the string as possible while still having the regexp match. In
this example, that means having the C<at> sequence with the final C<at>
-in the string. The other important principle illustrated here is that
+in the string. The other important principle illustrated here is that,
when there are two or more elements in a regexp, the I<leftmost>
-quantifier, if there is one, gets to grab as much the string as
+quantifier, if there is one, gets to grab as much of the string as
possible, leaving the rest of the regexp to fight over scraps. Thus in
our example, the first quantifier C<.*> grabs most of the string, while
the second quantifier C<.*> gets the empty string. Quantifiers that
-grab as much of the string as possible are called B<maximal match> or
-B<greedy> quantifiers.
+grab as much of the string as possible are called I<maximal match> or
+I<greedy> quantifiers.
When a regexp can match a string in several different ways, we can use
the principles above to predict which way the regexp will match:
=over 4
=item *
+
Principle 0: Taken as a whole, any regexp will be matched at the
earliest possible position in the string.
=item *
+
Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
that allows a match for the whole regexp will be the one used.
=item *
+
Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
C<{n,m}> will in general match as much of the string as possible while
still allowing the whole regexp to match.
=item *
+
Principle 3: If there are two or more elements in a regexp, the
leftmost greedy quantifier, if any, will match as much of the string
as possible while still allowing the whole regexp to match. The next
=back
-As we have seen above, Principle 0 overrides the others - the regexp
+As we have seen above, Principle 0 overrides the others. The regexp
will be matched as early as possible, with the other principles
determining how the regexp matches at that earliest character
position.
Sometimes greed is not good. At times, we would like quantifiers to
match a I<minimal> piece of string, rather than a maximal piece. For
-this purpose, Larry Wall created the S<B<minimal match> > or
-B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are
+this purpose, Larry Wall created the I<minimal match> or
+I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are
the usual quantifiers with a C<?> appended to them. They have the
following meanings:
=over 4
-=item * C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1.
+=item *
+
+C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1.
+
+=item *
-=item * C<a*?> = match 'a' 0 or more times, i.e., any number of times,
+C<a*?> means: match 'a' 0 or more times, i.e., any number of times,
but as few times as possible
-=item * C<a+?> = match 'a' 1 or more times, i.e., at least once, but
+=item *
+
+C<a+?> means: match 'a' 1 or more times, i.e., at least once, but
as few times as possible
-=item * C<a{n,m}?> = match at least C<n> times, not more than C<m>
+=item *
+
+C<a{n,m}?> means: match at least C<n> times, not more than C<m>
times, as few times as possible
-=item * C<a{n,}?> = match at least C<n> times, but as few times as
+=item *
+
+C<a{n,}?> means: match at least C<n> times, but as few times as
possible
-=item * C<a{n}?> = match exactly C<n> times. Because we match exactly
+=item *
+
+C<a{n}?> means: match exactly C<n> times. Because we match exactly
C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
notational consistency.
=over 4
=item *
+
Principle 3: If there are two or more elements in a regexp, the
leftmost greedy (non-greedy) quantifier, if any, will match as much
(little) of the string as possible while still allowing the whole
=over 4
-=item 0 Start with the first letter in the string 't'.
+=item Z<>0
+
+Start with the first letter in the string 't'.
-=item 1 The first quantifier '.*' starts out by matching the whole
+=item Z<>1
+
+The first quantifier '.*' starts out by matching the whole
string 'the cat in the hat'.
-=item 2 'a' in the regexp element 'at' doesn't match the end of the
+=item Z<>2
+
+'a' in the regexp element 'at' doesn't match the end of the
string. Backtrack one character.
-=item 3 'a' in the regexp element 'at' still doesn't match the last
+=item Z<>3
+
+'a' in the regexp element 'at' still doesn't match the last
letter of the string 't', so backtrack one more character.
-=item 4 Now we can match the 'a' and the 't'.
+=item Z<>4
+
+Now we can match the 'a' and the 't'.
-=item 5 Move on to the third element '.*'. Since we are at the end of
+=item Z<>5
+
+Move on to the third element '.*'. Since we are at the end of
the string and '.*' can match 0 times, assign it the empty string.
-=item 6 We are done!
+=item Z<>6
+
+We are done!
=back
Most of the time, all this moving forward and backtracking happens
-quickly and searching is fast. There are some pathological regexps,
+quickly and searching is fast. There are some pathological regexps,
however, whose execution time exponentially grows with the size of the
string. A typical structure that blows up in your face is of the form
and C<*>: one repetition with C<b+> of length n, two repetitions with
the first C<b+> length k and the second with length n-k, m repetitions
whose bits add up to length n, etc. In fact there are an exponential
-number of ways to partition a string as a function of length. A
+number of ways to partition a string as a function of its length. A
regexp may get lucky and match early in the process, but if there is
-no match, perl will try I<every> possibility before giving up. So be
+no match, Perl will try I<every> possibility before giving up. So be
careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
-I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful
+I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful
discussion of this and other efficiency issues.
+
+=head2 Possessive quantifiers
+
+Backtracking during the relentless search for a match may be a waste
+of time, particularly when the match is bound to fail. Consider
+the simple pattern
+
+ /^\w+\s+\w+$/; # a word, spaces, a word
+
+Whenever this is applied to a string which doesn't quite meet the
+pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>,
+the regex engine will backtrack, approximately once for each character
+in the string. But we know that there is no way around taking I<all>
+of the initial word characters to match the first repetition, that I<all>
+spaces must be eaten by the middle part, and the same goes for the second
+word.
+
+With the introduction of the I<possessive quantifiers> in Perl 5.10, we
+have a way of instructing the regex engine not to backtrack, with the
+usual quantifiers with a C<+> appended to them. This makes them greedy as
+well as stingy; once they succeed they won't give anything back to permit
+another solution. They have the following meanings:
+
+=over 4
+
+=item *
+
+C<a{n,m}+> means: match at least C<n> times, not more than C<m> times,
+as many times as possible, and don't give anything up. C<a?+> is short
+for C<a{0,1}+>
+
+=item *
+
+C<a{n,}+> means: match at least C<n> times, but as many times as possible,
+and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is
+short for C<a{1,}+>.
+
+=item *
+
+C<a{n}+> means: match exactly C<n> times. It is just there for
+notational consistency.
+
+=back
+
+These possessive quantifiers represent a special case of a more general
+concept, the I<independent subexpression>, see below.
+
+As an example where a possessive quantifier is suitable we consider
+matching a quoted string, as it appears in several programming languages.
+The backslash is used as an escape character that indicates that the
+next character is to be taken literally, as another character for the
+string. Therefore, after the opening quote, we expect a (possibly
+empty) sequence of alternatives: either some character except an
+unescaped quote or backslash or an escaped character.
+
+ /"(?:[^"\\]++|\\.)*+"/;
+
+
=head2 Building a regexp
At this point, we have all the basic regexp concepts covered, so let's
decimal point, otherwise they are integers. We might be tempted to
model these with C<\d*\.\d*>, but this would also match just a single
decimal point, which is not a number. So the three cases of floating
-point number sans exponent are
+point number without exponent are
/[+-]?\d+\./; # 1., 321., etc.
/[+-]?\.\d+/; # .1, .234, etc.
If whitespace is mostly irrelevant, how does one include space
characters in an extended regexp? The answer is to backslash it
-S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing
-goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
-a space between the sign and the mantissa/integer, and we could add
+S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing
+goes for pound signs: use C<\#> or C<[#]>. For instance, Perl allows
+a space between the sign and the mantissa or integer, and we could add
this to our regexp as follows:
/^
=over 4
-=item * specifying the task in detail,
+=item *
+
+specifying the task in detail,
+
+=item *
+
+breaking down the problem into smaller parts,
+
+=item *
-=item * breaking down the problem into smaller parts,
+translating the small parts into regexps,
-=item * translating the small parts into regexps,
+=item *
+
+combining the regexps,
-=item * combining the regexps,
+=item *
-=item * and optimizing the final combined regexp.
+and optimizing the final combined regexp.
=back
These are also the typical steps involved in writing a computer
program. This makes perfect sense, because regular expressions are
-essentially programs written a little computer language that specifies
+essentially programs written in a little computer language that specifies
patterns.
=head2 Using regular expressions in Perl
the binding operator C<=~> and its negation C<!~> to test for string
matches. Associated with the matching operator, we have discussed the
single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
-extended C<//x> modifiers.
-
-There are a few more things you might want to know about matching
-operators. First, we pointed out earlier that variables in regexps are
-substituted before the regexp is evaluated:
+extended C<//x> modifiers. There are a few more things you might
+want to know about matching operators.
- $pattern = 'Seuss';
- while (<>) {
- print if /$pattern/;
- }
-
-This will print any lines containing the word C<Seuss>. It is not as
-efficient as it could be, however, because perl has to re-evaluate
-C<$pattern> each time through the loop. If C<$pattern> won't be
-changing over the lifetime of the script, we can add the C<//o>
-modifier, which directs perl to only perform variable substitutions
-once:
-
- #!/usr/bin/perl
- # Improved simple_grep
- $regexp = shift;
- while (<>) {
- print if /$regexp/o; # a good deal faster
- }
+=head3 Prohibiting substitution
-If you change C<$pattern> after the first substitution happens, perl
+If you change C<$pattern> after the first substitution happens, Perl
will ignore it. If you don't want any substitutions at all, use the
special delimiter C<m''>:
- $pattern = 'Seuss';
+ @pattern = ('Seuss');
while (<>) {
- print if m'$pattern'; # matches '$pattern', not 'Seuss'
+ print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
}
-C<m''> acts like single quotes on a regexp; all other C<m> delimiters
-act like double quotes. If the regexp evaluates to the empty string,
+Similar to strings, C<m''> acts like apostrophes on a regexp; all other
+C<m> delimiters act like quotes. If the regexp evaluates to the empty string,
the regexp in the I<last successful match> is used instead. So we have
"dog" =~ /d/; # 'd' matches
"dogbert =~ //; # this matches the 'd' regexp used before
-The final two modifiers C<//g> and C<//c> concern multiple matches.
-The modifier C<//g> stands for global matching and allows the the
+
+=head3 Global matching
+
+The final two modifiers we will discuss here,
+C<//g> and C<//c>, concern multiple matches.
+The modifier C<//g> stands for global matching and allows the
matching operator to match within a string as many times as possible.
In scalar context, successive invocations against a string will have
-`C<//g> jump from match to match, keeping track of position in the
+C<//g> jump from match to match, keeping track of position in the
string as it goes along. You can get or set the position with the
C<pos()> function.
we wanted just the words, we could use
@words = ($x =~ /(\w+)/g); # matches,
- # $word[0] = 'cat'
- # $word[1] = 'dog'
- # $word[2] = 'house'
+ # $words[0] = 'cat'
+ # $words[1] = 'dog'
+ # $words[2] = 'house'
Closely associated with the C<//g> modifier is the C<\G> anchor. The
C<\G> anchor matches at the point where the previous C<//g> match left
The combination of C<//g> and C<\G> allows us to process the string a
bit at a time and use arbitrary Perl logic to decide what to do next.
+Currently, the C<\G> anchor is only fully supported when used to anchor
+to the start of the pattern.
-C<\G> is also invaluable in processing fixed length records with
+C<\G> is also invaluable in processing fixed-length records with
regexps. Suppose we have a snippet of coding region DNA, encoded as
base pair letters C<ATCGTTGAAT...> and we want to find all the stop
codons C<TGA>. In a coding region, codons are 3-letter sequences, so
$dna = "ATCGTTGAATGCAAATGACATGAC";
$dna =~ /TGA/;
-doesn't work; it may match an C<TGA>, but there is no guarantee that
+doesn't work; it may match a C<TGA>, but there is no guarantee that
the match is aligned with codon boundaries, e.g., the substring
-S<C<GTT GAA> > gives a match. A better solution is
+S<C<GTT GAA>> gives a match. A better solution is
while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
print "Got a TGA stop codon at position ", pos $dna, "\n";
important not only to match what is desired, but to reject what is not
desired.
-B<search and replace>
+(There are other regexp modifiers that are available, such as
+C<//o>, but their specialized uses are beyond the
+scope of this introduction. )
-Regular expressions also play a big role in B<search and replace>
+=head3 Search and replace
+
+Regular expressions also play a big role in I<search and replace>
operations in Perl. Search and replace is accomplished with the
C<s///> operator. The general form is
C<s/regexp/replacement/modifiers>, with everything we know about
regexps and modifiers applying in this case as well. The
-C<replacement> is a Perl double quoted string that replaces in the
+C<replacement> is a Perl double-quoted string that replaces in the
string whatever is matched with the C<regexp>. The operator C<=~> is
also used here to associate a string with C<s///>. If matching
-against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match,
-C<s///> returns the number of substitutions made, otherwise it returns
+against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match,
+C<s///> returns the number of substitutions made; otherwise it returns
false. Here are a few examples:
$x = "Time to feed the cat!";
In the last example, the whole string was matched, but only the part
inside the single quotes was grouped. With the C<s///> operator, the
-matched variables C<$1>, C<$2>, etc. are immediately available for use
+matched variables C<$1>, C<$2>, etc. are immediately available for use
in the replacement expression, so we use C<$1> to replace the quoted
string with just what was quoted. With the global modifier, C<s///g>
will search and replace all occurrences of the regexp in the string:
$regexp = shift;
$replacement = shift;
while (<>) {
- s/$regexp/$replacement/go;
+ s/$regexp/$replacement/g;
print;
}
^D
% simple_replace regexp regex perlretut.pod
In C<simple_replace> we used the C<s///g> modifier to replace all
-occurrences of the regexp on each line and the C<s///o> modifier to
-compile the regexp only once. As with C<simple_grep>, both the
-C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
+occurrences of the regexp on each line. (Even though the regular
+expression appears in a loop, Perl is smart enough to compile it
+only once.) As with C<simple_grep>, both the
+C<print> and the C<s/$regexp/$replacement/g> use C<$_> implicitly.
+
+If you don't want C<s///> to change your original variable you can use
+the non-destructive substitute modifier, C<s///r>. This changes the
+behavior so that C<s///r> returns the final substituted string
+(instead of the number of substitutions):
+
+ $x = "I like dogs.";
+ $y = $x =~ s/dogs/cats/r;
+ print "$x $y\n";
+
+That example will print "I like dogs. I like cats". Notice the original
+C<$x> variable has not been affected. The overall
+result of the substitution is instead stored in C<$y>. If the
+substitution doesn't affect anything then the original string is
+returned:
+
+ $x = "I like dogs.";
+ $y = $x =~ s/elephants/cougars/r;
+ print "$x $y\n"; # prints "I like dogs. I like dogs."
+
+One other interesting thing that the C<s///r> flag allows is chaining
+substitutions:
+
+ $x = "Cats are great.";
+ print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
+ s/Frogs/Hedgehogs/r, "\n";
+ # prints "Hedgehogs are great."
A modifier available specifically to search and replace is the
-C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
-the replacement string and the evaluated result is substituted for the
+C<s///e> evaluation modifier. C<s///e> treats the
+replacement text as Perl code, rather than a double-quoted
+string. The value that the code returns is substituted for the
matched substring. C<s///e> is useful if you need to do a bit of
computation in the process of replacing text. This example counts
character frequencies in a line:
$x = "Bill the cat";
- $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
+ $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
print "frequency of '$_' is $chars{$_}\n"
foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
As with the match C<m//> operator, C<s///> can use other delimiters,
such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
-used C<s'''>, then the regexp and replacement are treated as single
-quoted strings and there are no substitutions. C<s///> in list context
+used C<s'''>, then the regexp and replacement are
+treated as single-quoted strings and there are no
+variable substitutions. C<s///> in list context
returns the same thing as in scalar context, i.e., the number of
matches.
-B<The split operator>
+=head3 The split function
-The B<C<split> > function can also optionally use a matching operator
-C<m//> to split a string. C<split /regexp/, string, limit> splits
-C<string> into a list of substrings and returns that list. The regexp
-is used to match the character sequence that the C<string> is split
-with respect to. The C<limit>, if present, constrains splitting into
-no more than C<limit> number of strings. For example, to split a
-string into words, use
+The C<split()> function is another place where a regexp is used.
+C<split /regexp/, string, limit> separates the C<string> operand into
+a list of substrings and returns that list. The regexp must be designed
+to match whatever constitutes the separators for the desired substrings.
+The C<limit>, if present, constrains splitting into no more than C<limit>
+number of strings. For example, to split a string into words, use
$x = "Calvin and Hobbes";
@words = split /\s+/, $x; # $word[0] = 'Calvin'
If the empty regexp C<//> is used, the regexp always matches and
the string is split into individual characters. If the regexp has
-groupings, then list produced contains the matched substrings from the
+groupings, then the resulting list contains the matched substrings from the
groupings as well. For instance,
$x = "/usr/bin/perl";
If you have read this far, congratulations! You now have all the basic
tools needed to use regular expressions to solve a wide range of text
processing problems. If this is your first time through the tutorial,
-why not stop here and play around with regexps a while... S<Part 2>
+why not stop here and play around with regexps a while...
. S<Part 2>
concerns the more esoteric aspects of regular expressions and those
concepts certainly aren't needed right at the start.
matching regular expressions is analogous to a walk in the woods, then
the tools discussed in Part 1 are analogous to topo maps and a
compass, basic tools we use all the time. Most of the tools in part 2
-are are analogous to flare guns and satellite phones. They aren't used
+are analogous to flare guns and satellite phones. They aren't used
too often on a hike, but when we are stuck, they can be invaluable.
What follows are the more advanced, less used, or sometimes esoteric
-capabilities of perl regexps. In Part 2, we will assume you are
-comfortable with the basics and concentrate on the new features.
+capabilities of Perl regexps. In Part 2, we will assume you are
+comfortable with the basics and concentrate on the advanced features.
=head2 More on characters, strings, and character classes
haven't covered yet.
There are several escape sequences that convert characters or strings
-between upper and lower case. C<\l> and C<\u> convert the next
-character to lower or upper case, respectively:
+between upper and lower case, and they are also available within
+patterns. C<\l> and C<\u> convert the next character to lower or
+upper case, respectively:
$x = "perl";
$string =~ /\u$x/; # matches 'Perl' in $string
$x = "M(rs?|s)\\."; # note the double backslash
$string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
-C<\L> and C<\U> converts a whole substring, delimited by C<\L> or
-C<\U> and C<\E>, to lower or upper case:
+A C<\L> or C<\U> indicates a lasting conversion of case, until
+terminated by C<\E> or thrown over by another C<\U> or C<\L>:
$x = "This word is in lower case:\L SHOUT\E";
$x =~ /shout/; # matches
It does not protect C<$> or C<@>, so that variables can still be
substituted.
-With the advent of 5.6.0, perl regexps can handle more than just the
-standard ASCII character set. Perl now supports B<Unicode>, a standard
-for encoding the character sets from many of the world's written
-languages. Unicode does this by allowing characters to be more than
-one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters
-are still encoded as one byte, but characters greater than C<chr(127)>
-may be stored as two or more bytes.
+C<\Q>, C<\L>, C<\l>, C<\U>, C<\u> and C<\E> are actually part of
+double-quotish syntax, and not part of regexp syntax proper. They will
+work if they appear in a regular expression embedded directly in a
+program, but not when contained in a string that is interpolated in a
+pattern.
+
+Perl regexps can handle more than just the
+standard ASCII character set. Perl supports I<Unicode>, a standard
+for representing the alphabets from virtually all of the world's written
+languages, and a host of symbols. Perl's text strings are Unicode strings, so
+they can contain characters with a value (codepoint or character number) higher
+than 255.
What does this mean for regexps? Well, regexp users don't need to know
-much about perl's internal representation of strings. But they do need
-to know 1) how to represent Unicode characters in a regexp and 2) when
-a matching operation will treat the string to be searched as a
-sequence of bytes (the old way) or as a sequence of Unicode characters
-(the new way). The answer to 1) is that Unicode characters greater
-than C<chr(127)> may be represented using the C<\x{hex}> notation,
-with C<hex> a hexadecimal integer:
-
- use utf8; # We will be doing Unicode processing
+much about Perl's internal representation of strings. But they do need
+to know 1) how to represent Unicode characters in a regexp and 2) that
+a matching operation will treat the string to be searched as a sequence
+of characters, not bytes. The answer to 1) is that Unicode characters
+greater than C<chr(255)> are represented using the C<\x{hex}> notation, because
+\x hex (without curly braces) doesn't go further than 255. (Starting in Perl
+5.14, if you're an octal fan, you can also use C<\o{oct}>.)
+
/\x{263a}/; # match a Unicode smiley face :)
-Unicode characters in the range of 128-255 use two hexadecimal digits
-with braces: C<\x{ab}>. Note that this is different than C<\xab>,
-which is just a hexadecimal byte with no Unicode
-significance.
+B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use
+utf8> to use any Unicode features. This is no more the case: for
+almost all Unicode processing, the explicit C<utf8> pragma is not
+needed. (The only case where it matters is if your Perl script is in
+Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
Figuring out the hexadecimal sequence of a Unicode character you want
or deciphering someone else's hexadecimal Unicode regexp is about as
much fun as programming in machine code. So another way to specify
-Unicode characters is to use the S<B<named character> > escape
-sequence C<\N{name}>. C<name> is a name for the Unicode character, as
+Unicode characters is to use the I<named character> escape
+sequence C<\N{I<name>}>. I<name> is a name for the Unicode character, as
specified in the Unicode standard. For instance, if we wanted to
represent or match the astrological sign for the planet Mercury, we
could use
- use utf8; # We will be doing Unicode processing
- use charnames ":full"; # use named chars with Unicode full names
$x = "abc\N{MERCURY}def";
$x =~ /\N{MERCURY}/; # matches
-One can also use short names or restrict names to a certain alphabet:
-
- use utf8; # We will be doing Unicode processing
+One can also use "short" names:
- use charnames ':full';
print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
-
- use charnames ":short";
print "\N{greek:Sigma} is an upper-case sigma.\n";
+You can also restrict names to a certain alphabet by specifying the
+L<charnames> pragma:
+
use charnames qw(greek);
print "\N{sigma} is Greek sigma\n";
-A list of full names is found in the file Names.txt in the
-lib/perl5/5.6.0/unicode directory.
-
-The answer to requirement 2), as of 5.6.0, is that if a regexp
-contains Unicode characters, the string is searched as a sequence of
-Unicode characters. Otherwise, the string is searched as a sequence of
-bytes. If the string is being searched as a sequence of Unicode
-characters, but matching a single byte is required, we can use the C<\C>
-escape sequence. C<\C> is a character class akin to C<.> except that
-it matches I<any> byte 0-255. So
-
- use utf8; # We will be doing Unicode processing
- use charnames ":full"; # use named chars with Unicode full names
- $x = "a";
- $x =~ /\C/; # matches 'a', eats one byte
- $x = "";
- $x =~ /\C/; # doesn't match, no bytes to match
- $x = "\N{MERCURY}"; # two-byte Unicode character
- $x =~ /\C/; # matches, but dangerous!
-
-The last regexp matches, but is dangerous because the string
-I<character> position is no longer synchronized to the string I<byte>
-position. This generates the warning 'Malformed UTF-8
-character'. C<\C> is best used for matching the binary data in strings
-with binary data intermixed with Unicode characters.
-
-Let us now discuss the rest of the character classes. Just as with
-Unicode characters, there are named Unicode character classes
-represented by the C<\p{name}> escape sequence. Closely associated is
-the C<\P{name}> character class, which is the negation of the
-C<\p{name}> class. For example, to match lower and uppercase
-characters,
-
- use utf8; # We will be doing Unicode processing
- use charnames ":full"; # use named chars with Unicode full names
+An index of character names is available on-line from the Unicode
+Consortium, L<http://www.unicode.org/charts/charindex.html>; explanatory
+material with links to other resources at
+L<http://www.unicode.org/standard/where>.
+
+The answer to requirement 2) is that a regexp (mostly)
+uses Unicode characters. The "mostly" is for messy backward
+compatibility reasons, but starting in Perl 5.14, any regex compiled in
+the scope of a C<use feature 'unicode_strings'> (which is automatically
+turned on within the scope of a C<use 5.012> or higher) will turn that
+"mostly" into "always". If you want to handle Unicode properly, you
+should ensure that C<'unicode_strings'> is turned on.
+Internally, this is encoded to bytes using either UTF-8 or a native 8
+bit encoding, depending on the history of the string, but conceptually
+it is a sequence of characters, not bytes. See L<perlunitut> for a
+tutorial about that.
+
+Let us now discuss Unicode character classes, most usually called
+"character properties". These are represented by the
+C<\p{name}> escape sequence. Closely associated is the C<\P{name}>
+property, which is the negation of the C<\p{name}> one. For
+example, to match lower and uppercase characters,
+
$x = "BOB";
$x =~ /^\p{IsUpper}/; # matches, uppercase char class
$x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
$x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
$x =~ /^\P{IsLower}/; # matches, char class sans lowercase
-If a C<name> is just one letter, the braces can be dropped. For
-instance, C<\pM> is the character class of Unicode 'marks'. Here is
-the association between some Perl named classes and the traditional
-Unicode classes:
-
- Perl class name Unicode class name
-
- IsAlpha Lu, Ll, or Lo
- IsAlnum Lu, Ll, Lo, or Nd
- IsASCII $code le 127
- IsCntrl C
- IsDigit Nd
- IsGraph [^C] and $code ne "0020"
- IsLower Ll
- IsPrint [^C]
- IsPunct P
- IsSpace Z, or ($code lt "0020" and chr(hex $code) is a \s)
- IsUpper Lu
- IsWord Lu, Ll, Lo, Nd or $code eq "005F"
- IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
-
-For a full list of Perl class names, consult the mktables.PL program
-in the lib/perl5/5.6.0/unicode directory.
-
-C<\X> is an abbreviation for a character class sequence that includes
-the Unicode 'combining character sequences'. A 'combining character
-sequence' is a base character followed by any number of combining
-characters. An example of a combining character is an accent. Using
-the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining
-character sequence with base character C<A> and combining character
-S<C<COMBINING RING> >, which translates in Danish to A with the circle
-atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
-i.e., a non-mark followed by one or more marks.
-
-As if all those classes weren't enough, Perl also defines POSIX style
+(The "Is" is optional.)
+
+There are many, many Unicode character properties. For the full list
+see L<perluniprops>. Most of them have synonyms with shorter names,
+also listed there. Some synonyms are a single character. For these,
+you can drop the braces. For instance, C<\pM> is the same thing as
+C<\p{Mark}>, meaning things like accent marks.
+
+The Unicode C<\p{Script}> property is used to categorize every Unicode
+character into the language script it is written in. For example,
+English, French, and a bunch of other European languages are written in
+the Latin script. But there is also the Greek script, the Thai script,
+the Katakana script, etc. You can test whether a character is in a
+particular script with, for example C<\p{Latin}>, C<\p{Greek}>,
+or C<\p{Katakana}>. To test if it isn't in the Balinese script, you
+would use C<\P{Balinese}>.
+
+What we have described so far is the single form of the C<\p{...}> character
+classes. There is also a compound form which you may run into. These
+look like C<\p{name=value}> or C<\p{name:value}> (the equals sign and colon
+can be used interchangeably). These are more general than the single form,
+and in fact most of the single forms are just Perl-defined shortcuts for common
+compound forms. For example, the script examples in the previous paragraph
+could be written equivalently as C<\p{Script=Latin}>, C<\p{Script:Greek}>,
+C<\p{script=katakana}>, and C<\P{script=balinese}> (case is irrelevant
+between the C<{}> braces). You may
+never have to use the compound forms, but sometimes it is necessary, and their
+use can make your code easier to understand.
+
+C<\X> is an abbreviation for a character class that comprises
+a Unicode I<extended grapheme cluster>. This represents a "logical character":
+what appears to be a single character, but may be represented internally by more
+than one. As an example, using the Unicode full names, e.g., S<C<A + COMBINING
+RING>> is a grapheme cluster with base character C<A> and combining character
+S<C<COMBINING RING>>, which translates in Danish to A with the circle atop it,
+as in the word E<Aring>ngstrom.
+
+For the full and latest information about Unicode see the latest
+Unicode standard, or the Unicode Consortium's website L<http://www.unicode.org>
+
+As if all those classes weren't enough, Perl also defines POSIX-style
character classes. These have the form C<[:name:]>, with C<name> the
-name of the POSIX class. The POSIX classes are alpha, alnum, ascii,
-cntrl, digit, graph, lower, print, punct, space, upper, word, and
-xdigit. If C<utf8> is being used, then these classes are defined the
-same as their corresponding perl Unicode classes: C<[:upper:]> is the
-same as C<\p{IsUpper}>, etc. The POSIX character classes, however,
-don't require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
+name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
+C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
+C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
+extension to match C<\w>), and C<blank> (a GNU extension). The C<//a>
+modifier restricts these to matching just in the ASCII range; otherwise
+they can match the same as their corresponding Perl Unicode classes:
+C<[:upper:]> is the same as C<\p{IsUpper}>, etc. (There are some
+exceptions and gotchas with this; see L<perlrecharclass> for a full
+discussion.) The C<[:digit:]>, C<[:word:]>, and
C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
-character classes. To negate a POSIX class, put a C<^> in front of the
-name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
-C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
-be used just like C<\d>, both inside and outside of character classes:
+character classes. To negate a POSIX class, put a C<^> in front of
+the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and, under
+Unicode, C<\P{IsDigit}>. The Unicode and POSIX character classes can
+be used just like C<\d>, with the exception that POSIX character
+classes can only be used inside of a character class:
/\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
- /^=item\s[:digit:]/; # match '=item',
+ /^=item\s[[:digit:]]/; # match '=item',
# followed by a space and a digit
- use utf8;
- use charnames ":full";
/\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
/^=item\s\p{IsDigit}/; # match '=item',
# followed by a space and a digit
=head2 Compiling and saving regular expressions
-In Part 1 we discussed the C<//o> modifier, which compiles a regexp
-just once. This suggests that a compiled regexp is some data structure
+In Part 1 we mentioned that Perl compiles a regexp into a compact
+sequence of opcodes. Thus, a compiled regexp is a data structure
that can be stored once and used again and again. The regexp quote
C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
regexp and transforms the result into a form that can be assigned to a
$x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use different
-delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote
-delimiters C<qr''> prevent any interpolation from taking place.
+delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes
+as delimiters (C<qr''>) inhibit any interpolation.
Pre-compiled regexps are useful for creating dynamic matches that
don't need to be recompiled each time they are encountered. Using
-pre-compiled regexps, C<simple_grep> program can be expanded into a
-program that matches multiple patterns:
+pre-compiled regexps, we write a C<grep_step> program which greps
+for a sequence of patterns, advancing to the next pattern as soon
+as one has been satisfied.
- % cat > multi_grep
+ % cat > grep_step
#!/usr/bin/perl
- # multi_grep - match any of <number> regexps
+ # grep_step - match <number> regexps, one after the other
# usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
$number = shift;
$regexp[$_] = shift foreach (0..$number-1);
@compiled = map qr/$_/, @regexp;
while ($line = <>) {
- foreach $pattern (@compiled) {
- if ($line =~ /$pattern/) {
- print $line;
- last; # we matched, so move onto the next line
- }
+ if ($line =~ /$compiled[0]/) {
+ print $line;
+ shift @compiled;
+ last unless @compiled;
}
}
^D
- % multi_grep 2 last for multi_grep
- $regexp[$_] = shift foreach (0..$number-1);
- foreach $pattern (@compiled) {
- last;
+ % grep_step 3 shift print last grep_step
+ $number = shift;
+ print $line;
+ last unless @compiled;
Storing pre-compiled regexps in an array C<@compiled> allows us to
simply loop through the regexps without any recompilation, thus gaining
flexibility without sacrificing speed.
+
+=head2 Composing regular expressions at runtime
+
+Backtracking is more efficient than repeated tries with different regular
+expressions. If there are several regular expressions and a match with
+any of them is acceptable, then it is possible to combine them into a set
+of alternatives. If the individual expressions are input data, this
+can be done by programming a join operation. We'll exploit this idea in
+an improved version of the C<simple_grep> program: a program that matches
+multiple patterns:
+
+ % cat > multi_grep
+ #!/usr/bin/perl
+ # multi_grep - match any of <number> regexps
+ # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
+
+ $number = shift;
+ $regexp[$_] = shift foreach (0..$number-1);
+ $pattern = join '|', @regexp;
+
+ while ($line = <>) {
+ print $line if $line =~ /$pattern/;
+ }
+ ^D
+
+ % multi_grep 2 shift for multi_grep
+ $number = shift;
+ $regexp[$_] = shift foreach (0..$number-1);
+
+Sometimes it is advantageous to construct a pattern from the I<input>
+that is to be analyzed and use the permissible values on the left
+hand side of the matching operations. As an example for this somewhat
+paradoxical situation, let's assume that our input contains a command
+verb which should match one out of a set of available command verbs,
+with the additional twist that commands may be abbreviated as long as
+the given string is unique. The program below demonstrates the basic
+algorithm.
+
+ % cat > keymatch
+ #!/usr/bin/perl
+ $kwds = 'copy compare list print';
+ while( $cmd = <> ){
+ $cmd =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
+ if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
+ print "command: '@matches'\n";
+ } elsif( @matches == 0 ){
+ print "no such command: '$cmd'\n";
+ } else {
+ print "not unique: '$cmd' (could be one of: @matches)\n";
+ }
+ }
+ ^D
+
+ % keymatch
+ li
+ command: 'list'
+ co
+ not unique: 'co' (could be one of: copy compare)
+ printer
+ no such command: 'printer'
+
+Rather than trying to match the input against the keywords, we match the
+combined set of keywords against the input. The pattern matching
+operation S<C<$kwds =~ /\b($cmd\w*)/g>> does several things at the
+same time. It makes sure that the given command begins where a keyword
+begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It
+tells us the number of matches (C<scalar @matches>) and all the keywords
+that were actually matched. You could hardly ask for more.
+
=head2 Embedding comments and modifiers in a regular expression
Starting with this section, we will be discussing Perl's set of
-B<extended patterns>. These are extensions to the traditional regular
+I<extended patterns>. These are extensions to the traditional regular
expression syntax that provide powerful new tools for pattern
matching. We have already seen extensions in the form of the minimal
-matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
-rest of the extensions below have the form C<(?char...)>, where the
+matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. Most
+of the extensions below have the form C<(?char...)>, where the
C<char> is a character that determines the type of extension.
The first extension is an embedded comment C<(?#text)>. This embeds a
This style of commenting has been largely superseded by the raw,
freeform commenting that is allowed with the C<//x> modifier.
-The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in
+Most modifiers, such as C<//i>, C<//m>, C<//s> and C<//x> (or any
+combination thereof) can also be embedded in
a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
/(?i)yes/; # match 'yes' case insensitively
}
}
-The second advantage is that embedded modifiers only affect the regexp
+The second advantage is that embedded modifiers (except C<//p>, which
+modifies the entire regexp) only affect the regexp
inside the group the embedded modifier is contained in. So grouping
can be used to localize the modifier's effects:
a single expression, e.g., C<(?s-i)> turns on single line mode and
turns off case insensitivity.
-=head2 Non-capturing groupings
-
-We noted in Part 1 that groupings C<()> had two distinct functions: 1)
-group regexp elements together as a single unit, and 2) extract, or
-capture, substrings that matched the regexp in the
-grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the
-regexp to be treated as a single unit, but don't extract substrings or
-set matching variables C<$1>, etc. Both capturing and non-capturing
-groupings are allowed to co-exist in the same regexp. Because there is
-no extraction, non-capturing groupings are faster than capturing
-groupings. Non-capturing groupings are also handy for choosing exactly
-which parts of a regexp are to be extracted to matching variables:
-
- # match a number, $1-$4 are set, but we only want $1
- /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
-
- # match a number faster , only $1 is set
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
-
- # match a number, get $1 = whole number, $2 = exponent
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
-
-Non-capturing groupings are also useful for removing nuisance
-elements gathered from a split operation:
-
- $x = '12a34b5';
- @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5')
- @num = split /(?:a|b)/, $x; # @num = ('12','34','5')
-
-Non-capturing groupings may also have embedded modifiers:
+Embedded modifiers may also be added to a non-capturing grouping.
C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
case insensitively and turns off multi-line mode.
+
=head2 Looking ahead and looking behind
This section concerns the lookahead and lookbehind assertions. First,
In Perl regular expressions, most regexp elements 'eat up' a certain
amount of string when they match. For instance, the regexp element
C<[abc}]> eats up one character of the string when it matches, in the
-sense that perl moves to the next character position in the string
+sense that Perl moves to the next character position in the string
after the match. There are some elements, however, that don't eat up
characters (advance the character position) if they match. The examples
we have seen so far are the anchors. The anchor C<^> matches the
beginning of the line, but doesn't eat any characters. Similarly, the
-word boundary anchor C<\b> matches, e.g., if the character to the left
-is a word character and the character to the right is a non-word
-character, but it doesn't eat up any characters itself. Anchors are
-examples of 'zero-width assertions'. Zero-width, because they consume
+word boundary anchor C<\b> matches wherever a character matching C<\w>
+is next to a character that doesn't, but it doesn't eat up any
+characters itself. Anchors are examples of I<zero-width assertions>:
+zero-width, because they consume
no characters, and assertions, because they test some property of the
string. In the context of our walk in the woods analogy to regexp
matching, most regexp elements move us along a trail, but anchors have
looking behind, or both. C<^> looks behind, to see that there are no
characters before. C<$> looks ahead, to see that there are no
characters after. C<\b> looks both ahead and behind, to see if the
-characters on either side differ in their 'word'-ness.
+characters on either side differ in their "word-ness".
The lookahead and lookbehind assertions are generalizations of the
anchor concept. Lookahead and lookbehind are zero-width assertions
assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
$x = "I catch the housecat 'Tom-cat' with catnip";
- $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat'
+ $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
@catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
# $catwords[0] = 'catch'
# $catwords[1] = 'catnip'
$x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
$x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
-=head2 Using independent subexpressions to prevent backtracking
+The C<\C> is unsupported in lookbehind, because the already
+treacherous definition of C<\C> would become even more so
+when going backwards.
+
+Here is an example where a string containing blank-separated words,
+numbers and single dashes is to be split into its components.
+Using C</\s+/> alone won't work, because spaces are not required between
+dashes, or a word or a dash. Additional places for a split are established
+by looking ahead and behind:
-The last few extended patterns in this tutorial are experimental as of
-5.6.0. Play with them, use them in some code, but don't rely on them
-just yet for production code.
+ $str = "one two - --6-8";
+ @toks = split / \s+ # a run of spaces
+ | (?<=\S) (?=-) # any non-space followed by '-'
+ | (?<=-) (?=\S) # a '-' followed by any non-space
+ /x, $str; # @toks = qw(one two - - - 6 - 8)
+
+
+=head2 Using independent subexpressions to prevent backtracking
-S<B<Independent subexpressions> > are regular expressions, in the
+I<Independent subexpressions> are regular expressions, in the
context of a larger regular expression, that function independently of
the larger regular expression. That is, they consume as much or as
little of the string as they wish without regard for the ability of
The independent subexpression C<< (?>a*) >> doesn't care about the rest
of the regexp, so it sees an C<a> and grabs it. Then the rest of the
regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
-is no backtracking and and the independent subexpression does not give
+is no backtracking and the independent subexpression does not give
up its C<a>. Thus the match of the regexp as a whole fails. A similar
behavior occurs with completely independent regexps:
parentheses and the second alternative C<\([^()]*\)> matching a
substring delimited by parentheses. The problem with this regexp is
that it is pathological: it has nested indeterminate quantifiers
- of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
+of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
like this could take an exponentially long time to execute if there
was no match possible. To prevent the exponential blowup, we need to
prevent useless backtracking at some point. This can be done by
by gobbling up as much of the string as possible and keeping it. Then
match failures fail much more quickly.
+
=head2 Conditional expressions
-A S<B<conditional expression> > is a form of if-then-else statement
+A I<conditional expression> is a form of if-then-else statement
that allows one to choose which patterns are to be matched, based on
some condition. There are two types of conditional expression:
C<(?(condition)yes-regexp)> and
C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
-like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true,
+like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true,
the C<yes-regexp> will be matched. If the C<condition> is false, the
-C<yes-regexp> will be skipped and perl will move onto the next regexp
-element. The second form is like an S<C<'if () {} else {}'> > statement
+C<yes-regexp> will be skipped and Perl will move onto the next regexp
+element. The second form is like an S<C<'if () {} else {}'>> statement
in Perl. If the C<condition> is true, the C<yes-regexp> will be
matched, otherwise the C<no-regexp> will be matched.
-The C<condition> can have two forms. The first form is simply an
+The C<condition> can have several forms. The first form is simply an
integer in parentheses C<(integer)>. It is true if the corresponding
-backreference C<\integer> matched earlier in the regexp. The second
-form is a bare zero width assertion C<(?...)>, either a
-lookahead, a lookbehind, or a code assertion (discussed in the next
-section).
-
-The integer form of the C<condition> allows us to choose, with more
-flexibility, what to match based on what matched earlier in the
-regexp. This searches for words of the form C<"$x$x"> or
-C<"$x$y$y$x">:
-
- % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
+backreference C<\integer> matched earlier in the regexp. The same
+thing can be done with a name associated with a capture group, written
+as C<< (<name>) >> or C<< ('name') >>. The second form is a bare
+zero-width assertion C<(?...)>, either a lookahead, a lookbehind, or a
+code assertion (discussed in the next section). The third set of forms
+provides tests that return true if the expression is executed within
+a recursion (C<(R)>) or is being called from some capturing group,
+referenced either by number (C<(R1)>, C<(R2)>,...) or by name
+(C<(R&name)>).
+
+The integer or name form of the C<condition> allows us to choose,
+with more flexibility, what to match based on what matched earlier in the
+regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">:
+
+ % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
beriberi
coco
couscous
lookahead, lookbehind or code assertions, the parentheses around the
conditional are not needed.
+
+=head2 Defining named patterns
+
+Some regular expressions use identical subpatterns in several places.
+Starting with Perl 5.10, it is possible to define named subpatterns in
+a section of the pattern so that they can be called up by name
+anywhere in the pattern. This syntactic pattern for this definition
+group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion
+of a named pattern is written as C<(?&name)>.
+
+The example below illustrates this feature using the pattern for
+floating point numbers that was presented earlier on. The three
+subpatterns that are used more than once are the optional sign, the
+digit sequence for an integer and the decimal fraction. The DEFINE
+group at the end of the pattern contains their definition. Notice
+that the decimal fraction pattern is the first place where we can
+reuse the integer pattern.
+
+ /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
+ (?: [eE](?&osg)(?&int) )?
+ $
+ (?(DEFINE)
+ (?<osg>[-+]?) # optional sign
+ (?<int>\d++) # integer
+ (?<dec>\.(?&int)) # decimal fraction
+ )/x
+
+
+=head2 Recursive patterns
+
+This feature (introduced in Perl 5.10) significantly extends the
+power of Perl's pattern matching. By referring to some other
+capture group anywhere in the pattern with the construct
+C<(?group-ref)>, the I<pattern> within the referenced group is used
+as an independent subpattern in place of the group reference itself.
+Because the group reference may be contained I<within> the group it
+refers to, it is now possible to apply pattern matching to tasks that
+hitherto required a recursive parser.
+
+To illustrate this feature, we'll design a pattern that matches if
+a string contains a palindrome. (This is a word or a sentence that,
+while ignoring spaces, interpunctuation and case, reads the same backwards
+as forwards. We begin by observing that the empty string or a string
+containing just one word character is a palindrome. Otherwise it must
+have a word character up front and the same at its end, with another
+palindrome in between.
+
+ /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
+
+Adding C<\W*> at either end to eliminate what is to be ignored, we already
+have the full pattern:
+
+ my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
+ for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
+ print "'$s' is a palindrome\n" if $s =~ /$pp/;
+ }
+
+In C<(?...)> both absolute and relative backreferences may be used.
+The entire pattern can be reinserted with C<(?R)> or C<(?0)>.
+If you prefer to name your groups, you can use C<(?&name)> to
+recurse into that group.
+
+
=head2 A bit of magic: executing Perl code in a regular expression
Normally, regexps are a part of Perl expressions.
-S<B<Code evaluation> > expressions turn that around by allowing
-arbitrary Perl code to be a part of of a regexp. A code evaluation
-expression is denoted C<(?{code})>, with C<code> a string of Perl
+I<Code evaluation> expressions turn that around by allowing
+arbitrary Perl code to be a part of a regexp. A code evaluation
+expression is denoted C<(?{code})>, with I<code> a string of Perl
statements.
+Be warned that this feature is considered experimental, and may be
+changed without notice.
+
Code expressions are zero-width assertions, and the value they return
depends on their environment. There are two possibilities: either the
code expression is used as a conditional in a conditional expression
# prints 'Hi Mom!'
$x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
# no 'Hi Mom!'
+
+Pay careful attention to the next example:
+
$x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
# no 'Hi Mom!'
+ # but why not?
+
+At first glance, you'd think that it shouldn't print, because obviously
+the C<ddd> isn't going to match the target string. But look at this
+example:
+
+ $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
+ # but _does_ print
+
+Hmm. What happened here? If you've been following along, you know that
+the above pattern should be effectively (almost) the same as the last one;
+enclosing the C<d> in a character class isn't going to change what it
+matches. So why does the first not print while the second one does?
+
+The answer lies in the optimizations the regex engine makes. In the first
+case, all the engine sees are plain old characters (aside from the
+C<?{}> construct). It's smart enough to realize that the string 'ddd'
+doesn't occur in our target string before actually running the pattern
+through. But in the second case, we've tricked it into thinking that our
+pattern is more complicated. It takes a look, sees our
+character class, and decides that it will have to actually run the
+pattern to determine whether or not it matches, and in the process of
+running it hits the print statement before it discovers that we don't
+have a match.
+
+To take a closer look at how the engine does optimizations, see the
+section L<"Pragmas and debugging"> below.
+
+More fun with C<?{}>:
+
$x =~ /(?{print "Hi Mom!";})/; # matches,
# prints 'Hi Mom!'
$x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
'a' count is 2, $c variable is 'bob'
-If we replace the S<C< (?{local $c = $c + 1;})> > with
-S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone
+If we replace the S<C< (?{local $c = $c + 1;})>> with
+S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone
during backtracking, and we get
'a' count is 4, $c variable is 'bob'
The result C<$^R> is automatically localized, so that it will behave
properly in the presence of backtracking.
-This example uses a code expression in a conditional to match the
-article 'the' in either English or German:
+This example uses a code expression in a conditional to match a
+definite article, either 'the' in English or 'der|die|das' in German:
$lang = 'DE'; # use German
...
$lang eq 'EN'; # is the language English?
})
the | # if so, then match 'the'
- (die|das|der) # else, match 'die|das|der'
+ (der|die|das) # else, match 'der|die|das'
)
/xi;
code expression, we don't need the extra parentheses around the
conditional.
-If you try to use code expressions with interpolating variables, perl
-may surprise you:
+If you try to use code expressions where the code text is contained within
+an interpolated variable, rather than appearing literally in the pattern,
+Perl may surprise you:
$bar = 5;
$pat = '(?{ 1 })';
/foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
- /foo(?{ 1 })$bar/; # compile error!
+ /foo(?{ 1 })$bar/; # compiles ok, $bar interpolated
/foo${pat}bar/; # compile error!
$pat = qr/(?{ $foo = 1 })/; # precompile code regexp
/foo${pat}bar/; # compiles ok
-If a regexp has (1) code expressions and interpolating variables,or
-(2) a variable that interpolates a code expression, perl treats the
-regexp as an error. If the code expression is precompiled into a
-variable, however, interpolating is ok. The question is, why is this
-an error?
+If a regexp has a variable that interpolates a code expression, Perl
+treats the regexp as an error. If the code expression is precompiled into
+a variable, however, interpolating is ok. The question is, why is this an
+error?
The reason is that variable interpolation and code expressions
together pose a security risk. The combination is dangerous because
If the C<$regexp> variable contains a code expression, the user could
then execute arbitrary Perl code. For instance, some joker could
-search for S<C<system('rm -rf *');> > to erase your files. In this
-sense, the combination of interpolation and code expressions B<taints>
+search for S<C<system('rm -rf *');>> to erase your files. In this
+sense, the combination of interpolation and code expressions I<taints>
your regexp. So by default, using both interpolation and code
expressions in the same regexp is not allowed. If you're not
concerned about malicious users, it is possible to bypass this
-security check by invoking S<C<use re 'eval'> >:
+security check by invoking S<C<use re 'eval'>>:
use re 'eval'; # throw caution out the door
$bar = 5;
$pat = '(?{ 1 })';
- /foo(?{ 1 })$bar/; # compiles ok
/foo${pat}bar/; # compiles ok
-Another form of code expression is the S<B<pattern code expression> >.
+Another form of code expression is the I<pattern code expression>.
The pattern code expression is like a regular code expression, except
that the result of the code evaluation is treated as a regular
expression and matched immediately. A simple example is
This final example contains both ordinary and pattern code
-expressions. It detects if a binary string C<1101010010001...> has a
+expressions. It detects whether a binary string C<1101010010001...> has a
Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
- $s0 = 0; $s1 = 1; # initial conditions
$x = "1101010010001000001";
+ $z0 = ''; $z1 = '0'; # initial conditions
print "It is a Fibonacci sequence\n"
if $x =~ /^1 # match an initial '1'
- (
- (??{'0' x $s0}) # match $s0 of '0'
- 1 # and then a '1'
- (?{
- $largest = $s0; # largest seq so far
- $s2 = $s1 + $s0; # compute next term
- $s0 = $s1; # in Fibonacci sequence
- $s1 = $s2;
- })
+ (?:
+ ((??{ $z0 })) # match some '0'
+ 1 # and then a '1'
+ (?{ $z0 = $z1; $z1 .= $^N; })
)+ # repeat as needed
$ # that is all there is
/x;
- print "Largest sequence matched was $largest\n";
+ printf "Largest sequence matched was %d\n", length($z1)-length($z0);
-This prints
+Remember that C<$^N> is set to whatever was matched by the last
+completed capture group. This prints
It is a Fibonacci sequence
Largest sequence matched was 5
Ha! Try that with your garden variety regexp package...
-Note that the variables C<$s0> and C<$s1> are not substituted when the
+Note that the variables C<$z0> and C<$z1> are not substituted when the
regexp is compiled, as happens for ordinary variables outside a code
-expression. Rather, the code expressions are evaluated when perl
-encounters them during the search for a match.
+expression. Rather, the whole code block is parsed as perl code at the
+same time as perl is compiling the code containing the literal regexp
+pattern.
The regexp without the C<//x> modifier is
- /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;
+ /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
+
+which shows that spaces are still possible in the code parts. Nevertheless,
+when working with code and conditional expressions, the extended form of
+regexps is almost necessary in creating and debugging regexps.
+
+
+=head2 Backtracking control verbs
+
+Perl 5.10 introduced a number of control verbs intended to provide
+detailed control over the backtracking process, by directly influencing
+the regexp engine and by providing monitoring techniques. As all
+the features in this group are experimental and subject to change or
+removal in a future version of Perl, the interested reader is
+referred to L<perlre/"Special Backtracking Control Verbs"> for a
+detailed description.
+
+Below is just one example, illustrating the control verb C<(*FAIL)>,
+which may be abbreviated as C<(*F)>. If this is inserted in a regexp
+it will cause it to fail, just as it would at some
+mismatch between the pattern and the string. Processing
+of the regexp continues as it would after any "normal"
+failure, so that, for instance, the next position in the string or another
+alternative will be tried. As failing to match doesn't preserve capture
+groups or produce results, it may be necessary to use this in
+combination with embedded code.
+
+ %count = ();
+ "supercalifragilisticexpialidocious" =~
+ /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
+ printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
+
+The pattern begins with a class matching a subset of letters. Whenever
+this matches, a statement like C<$count{'a'}++;> is executed, incrementing
+the letter's counter. Then C<(*FAIL)> does what it says, and
+the regexp engine proceeds according to the book: as long as the end of
+the string hasn't been reached, the position is advanced before looking
+for another vowel. Thus, match or no match makes no difference, and the
+regexp engine proceeds until the entire string has been inspected.
+(It's remarkable that an alternative solution using something like
+
+ $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
+ printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
+
+is considerably slower.)
-and is a great start on an Obfuscated Perl entry :-) When working with
-code and conditional expressions, the extended form of regexps is
-almost necessary in creating and debugging regexps.
=head2 Pragmas and debugging
Speaking of debugging, there are several pragmas available to control
and debug regexps in Perl. We have already encountered one pragma in
-the previous section, S<C<use re 'eval';> >, that allows variable
+the previous section, S<C<use re 'eval';>>, that allows variable
interpolation and code expressions to coexist in a regexp. The other
pragmas are
are lexically scoped, which means they are in effect only until
the end of the block enclosing the pragmas.
+ use re '/m'; # or any other flags
+ $multiline_string =~ /^foo/; # /m is implied
+
+The C<re '/flags'> pragma (introduced in Perl
+5.14) turns on the given regular expression flags
+until the end of the lexical scope. See
+L<re/"'E<sol>flags' mode"> for more
+detail.
+
use re 'debug';
/^(.*)$/s; # output debugging info
termcap color sequences. Here is example output:
% perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
- Compiling REx `a*b+c'
+ Compiling REx 'a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
5: EXACT <b>(0)
7: EXACT <c>(9)
9: END(0)
- floating `bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx `a*b+c' against `abc'...
- Found floating substr `bc' at offset 1...
+ floating 'bc' at 0..2147483647 (checking floating) minlen 2
+ Guessing start of match, REx 'a*b+c' against 'abc'...
+ Found floating substr 'bc' at offset 1...
Guessed: match at offset 0
- Matching REx `a*b+c' against `abc'
+ Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
-
EXACT <a> can match 1 times out of 32767...
+ 0 <> <abc> | 1: STAR
+ EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
+ 1 <a> <bc> | 4: PLUS
+ EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
+ 2 <ab> <c> | 7: EXACT <c>
+ 3 <abc> <> | 9: END
Match successful!
- Freeing REx: `a*b+c'
+ Freeing REx: 'a*b+c'
If you have gotten this far into the tutorial, you can probably guess
what the different parts of the debugging output tell you. The first
part
- Compiling REx `a*b+c'
+ Compiling REx 'a*b+c'
size 9 first at 1
1: STAR(4)
2: EXACT <a>(0)
i.e., C<PLUS(7)>. The middle lines describe some heuristics and
optimizations performed before a match:
- floating `bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx `a*b+c' against `abc'...
- Found floating substr `bc' at offset 1...
+ floating 'bc' at 0..2147483647 (checking floating) minlen 2
+ Guessing start of match, REx 'a*b+c' against 'abc'...
+ Found floating substr 'bc' at offset 1...
Guessed: match at offset 0
Then the match is executed and the remaining lines describe the
process:
- Matching REx `a*b+c' against `abc'
+ Matching REx 'a*b+c' against 'abc'
Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
-
EXACT <a> can match 1 times out of 32767...
+ 0 <> <abc> | 1: STAR
+ EXACT <a> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
+ 1 <a> <bc> | 4: PLUS
+ EXACT <b> can match 1 times out of 32767...
Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
+ 2 <ab> <c> | 7: EXACT <c>
+ 3 <abc> <> | 9: END
Match successful!
- Freeing REx: `a*b+c'
+ Freeing REx: 'a*b+c'
-Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the
+Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the
part of the string matched and C<< <y> >> the part not yet
-matched. The S<C<< | 1: STAR >> > says that perl is at line number 1
-n the compilation list above. See
-L<perldebguts/"Debugging regular expressions"> for much more detail.
+matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1
+in the compilation list above. See
+L<perldebguts/"Debugging Regular Expressions"> for much more detail.
An alternative method of debugging regexps is to embed C<print>
statements within the regexp. This provides a blow-by-blow account of
=head1 BUGS
Code expressions, conditional expressions, and independent expressions
-are B<experimental>. Don't use them in production code. Yet.
+are I<experimental>. Don't use them in production code. Yet.
=head1 SEE ALSO
-This is just a tutorial. For the full story on perl regular
+This is just a tutorial. For the full story on Perl regular
expressions, see the L<perlre> regular expressions reference page.
For more information on the matching C<m//> and substitution C<s///>
https://perl5.git.perl.org / perl5.git / blobdiff