This is a live mirror of the Perl 5 development currently hosted at https://github.com/perl/perl5
perldelta for deprecating ${^ENCODING}
[perl5.git] / pod / perlretut.pod
... / ...
CommitLineData
1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting-edge innovations.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
62What is this Perl statement all about? C<"Hello World"> is a simple
63double-quoted string. C<World> is the regular expression and the
64C<//> enclosing C</World/> tells Perl to search a string for a match.
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
79be reversed by using the C<!~> operator:
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
118same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in this regexp
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
131S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
140If a regexp matches in more than one place in the string, Perl will
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
148is' in a match. Some characters, called I<metacharacters>, are reserved
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
161 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
168 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
169
170The backslash character C<'\'> is a metacharacter itself and needs to
171be backslashed:
172
173 'C:\WIN32' =~ /C:\\WIN/; # matches
174
175In addition to the metacharacters, there are some ASCII characters
176which don't have printable character equivalents and are instead
177represented by I<escape sequences>. Common examples are C<\t> for a
178tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
179bell (or alert). If your string is better thought of as a sequence of arbitrary
180bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181sequence, e.g., C<\x1B> may be a more natural representation for your
182bytes. Here are some examples of escapes:
183
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
187 "cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
188 # to spell cat
189
190If you've been around Perl a while, all this talk of escape sequences
191may seem familiar. Similar escape sequences are used in double-quoted
192strings and in fact the regexps in Perl are mostly treated as
193double-quoted strings. This means that variables can be used in
194regexps as well. Just like double-quoted strings, the values of the
195variables in the regexp will be substituted in before the regexp is
196evaluated for matching purposes. So we have:
197
198 $foo = 'house';
199 'housecat' =~ /$foo/; # matches
200 'cathouse' =~ /cat$foo/; # matches
201 'housecat' =~ /${foo}cat/; # matches
202
203So far, so good. With the knowledge above you can already perform
204searches with just about any literal string regexp you can dream up.
205Here is a I<very simple> emulation of the Unix grep program:
206
207 % cat > simple_grep
208 #!/usr/bin/perl
209 $regexp = shift;
210 while (<>) {
211 print if /$regexp/;
212 }
213 ^D
214
215 % chmod +x simple_grep
216
217 % simple_grep abba /usr/dict/words
218 Babbage
219 cabbage
220 cabbages
221 sabbath
222 Sabbathize
223 Sabbathizes
224 sabbatical
225 scabbard
226 scabbards
227
228This program is easy to understand. C<#!/usr/bin/perl> is the standard
229way to invoke a perl program from the shell.
230S<C<$regexp = shift;>> saves the first command line argument as the
231regexp to be used, leaving the rest of the command line arguments to
232be treated as files. S<C<< while (<>) >>> loops over all the lines in
233all the files. For each line, S<C<print if /$regexp/;>> prints the
234line if the regexp matches the line. In this line, both C<print> and
235C</$regexp/> use the default variable C<$_> implicitly.
236
237With all of the regexps above, if the regexp matched anywhere in the
238string, it was considered a match. Sometimes, however, we'd like to
239specify I<where> in the string the regexp should try to match. To do
240this, we would use the I<anchor> metacharacters C<^> and C<$>. The
241anchor C<^> means match at the beginning of the string and the anchor
242C<$> means match at the end of the string, or before a newline at the
243end of the string. Here is how they are used:
244
245 "housekeeper" =~ /keeper/; # matches
246 "housekeeper" =~ /^keeper/; # doesn't match
247 "housekeeper" =~ /keeper$/; # matches
248 "housekeeper\n" =~ /keeper$/; # matches
249
250The second regexp doesn't match because C<^> constrains C<keeper> to
251match only at the beginning of the string, but C<"housekeeper"> has
252keeper starting in the middle. The third regexp does match, since the
253C<$> constrains C<keeper> to match only at the end of the string.
254
255When both C<^> and C<$> are used at the same time, the regexp has to
256match both the beginning and the end of the string, i.e., the regexp
257matches the whole string. Consider
258
259 "keeper" =~ /^keep$/; # doesn't match
260 "keeper" =~ /^keeper$/; # matches
261 "" =~ /^$/; # ^$ matches an empty string
262
263The first regexp doesn't match because the string has more to it than
264C<keep>. Since the second regexp is exactly the string, it
265matches. Using both C<^> and C<$> in a regexp forces the complete
266string to match, so it gives you complete control over which strings
267match and which don't. Suppose you are looking for a fellow named
268bert, off in a string by himself:
269
270 "dogbert" =~ /bert/; # matches, but not what you want
271
272 "dilbert" =~ /^bert/; # doesn't match, but ..
273 "bertram" =~ /^bert/; # matches, so still not good enough
274
275 "bertram" =~ /^bert$/; # doesn't match, good
276 "dilbert" =~ /^bert$/; # doesn't match, good
277 "bert" =~ /^bert$/; # matches, perfect
278
279Of course, in the case of a literal string, one could just as easily
280use the string comparison S<C<$string eq 'bert'>> and it would be
281more efficient. The C<^...$> regexp really becomes useful when we
282add in the more powerful regexp tools below.
283
284=head2 Using character classes
285
286Although one can already do quite a lot with the literal string
287regexps above, we've only scratched the surface of regular expression
288technology. In this and subsequent sections we will introduce regexp
289concepts (and associated metacharacter notations) that will allow a
290regexp to represent not just a single character sequence, but a I<whole
291class> of them.
292
293One such concept is that of a I<character class>. A character class
294allows a set of possible characters, rather than just a single
295character, to match at a particular point in a regexp. You can define
296your own custom character classes. These
297are denoted by brackets C<[...]>, with the set of characters
298to be possibly matched inside. Here are some examples:
299
300 /cat/; # matches 'cat'
301 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
302 /item[0123456789]/; # matches 'item0' or ... or 'item9'
303 "abc" =~ /[cab]/; # matches 'a'
304
305In the last statement, even though C<'c'> is the first character in
306the class, C<'a'> matches because the first character position in the
307string is the earliest point at which the regexp can match.
308
309 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
310 # 'yes', 'Yes', 'YES', etc.
311
312This regexp displays a common task: perform a case-insensitive
313match. Perl provides a way of avoiding all those brackets by simply
314appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
315can be rewritten as C</yes/i;>. The C<'i'> stands for
316case-insensitive and is an example of a I<modifier> of the matching
317operation. We will meet other modifiers later in the tutorial.
318
319We saw in the section above that there were ordinary characters, which
320represented themselves, and special characters, which needed a
321backslash C<\> to represent themselves. The same is true in a
322character class, but the sets of ordinary and special characters
323inside a character class are different than those outside a character
324class. The special characters for a character class are C<-]\^$> (and
325the pattern delimiter, whatever it is).
326C<]> is special because it denotes the end of a character class. C<$> is
327special because it denotes a scalar variable. C<\> is special because
328it is used in escape sequences, just like above. Here is how the
329special characters C<]$\> are handled:
330
331 /[\]c]def/; # matches ']def' or 'cdef'
332 $x = 'bcr';
333 /[$x]at/; # matches 'bat', 'cat', or 'rat'
334 /[\$x]at/; # matches '$at' or 'xat'
335 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
336
337The last two are a little tricky. In C<[\$x]>, the backslash protects
338the dollar sign, so the character class has two members C<$> and C<x>.
339In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
340variable and substituted in double quote fashion.
341
342The special character C<'-'> acts as a range operator within character
343classes, so that a contiguous set of characters can be written as a
344range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
345become the svelte C<[0-9]> and C<[a-z]>. Some examples are
346
347 /item[0-9]/; # matches 'item0' or ... or 'item9'
348 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
349 # 'baa', 'xaa', 'yaa', or 'zaa'
350 /[0-9a-fA-F]/; # matches a hexadecimal digit
351 /[0-9a-zA-Z_]/; # matches a "word" character,
352 # like those in a Perl variable name
353
354If C<'-'> is the first or last character in a character class, it is
355treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
356all equivalent.
357
358The special character C<^> in the first position of a character class
359denotes a I<negated character class>, which matches any character but
360those in the brackets. Both C<[...]> and C<[^...]> must match a
361character, or the match fails. Then
362
363 /[^a]at/; # doesn't match 'aat' or 'at', but matches
364 # all other 'bat', 'cat, '0at', '%at', etc.
365 /[^0-9]/; # matches a non-numeric character
366 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
367
368Now, even C<[0-9]> can be a bother to write multiple times, so in the
369interest of saving keystrokes and making regexps more readable, Perl
370has several abbreviations for common character classes, as shown below.
371Since the introduction of Unicode, unless the C<//a> modifier is in
372effect, these character classes match more than just a few characters in
373the ASCII range.
374
375=over 4
376
377=item *
378
379\d matches a digit, not just [0-9] but also digits from non-roman scripts
380
381=item *
382
383\s matches a whitespace character, the set [\ \t\r\n\f] and others
384
385=item *
386
387\w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]
388but also digits and characters from non-roman scripts
389
390=item *
391
392\D is a negated \d; it represents any other character than a digit, or [^\d]
393
394=item *
395
396\S is a negated \s; it represents any non-whitespace character [^\s]
397
398=item *
399
400\W is a negated \w; it represents any non-word character [^\w]
401
402=item *
403
404The period '.' matches any character but "\n" (unless the modifier C<//s> is
405in effect, as explained below).
406
407=item *
408
409\N, like the period, matches any character but "\n", but it does so
410regardless of whether the modifier C<//s> is in effect.
411
412=back
413
414The C<//a> modifier, available starting in Perl 5.14, is used to
415restrict the matches of \d, \s, and \w to just those in the ASCII range.
416It is useful to keep your program from being needlessly exposed to full
417Unicode (and its accompanying security considerations) when all you want
418is to process English-like text. (The "a" may be doubled, C<//aa>, to
419provide even more restrictions, preventing case-insensitive matching of
420ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign"
421would caselessly match a "k" or "K".)
422
423The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
424of bracketed character classes. Here are some in use:
425
426 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
427 /[\d\s]/; # matches any digit or whitespace character
428 /\w\W\w/; # matches a word char, followed by a
429 # non-word char, followed by a word char
430 /..rt/; # matches any two chars, followed by 'rt'
431 /end\./; # matches 'end.'
432 /end[.]/; # same thing, matches 'end.'
433
434Because a period is a metacharacter, it needs to be escaped to match
435as an ordinary period. Because, for example, C<\d> and C<\w> are sets
436of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
437fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
438C<[\W]>. Think DeMorgan's laws.
439
440In actuality, the period and C<\d\s\w\D\S\W> abbreviations are
441themselves types of character classes, so the ones surrounded by
442brackets are just one type of character class. When we need to make a
443distinction, we refer to them as "bracketed character classes."
444
445An anchor useful in basic regexps is the I<word anchor>
446C<\b>. This matches a boundary between a word character and a non-word
447character C<\w\W> or C<\W\w>:
448
449 $x = "Housecat catenates house and cat";
450 $x =~ /cat/; # matches cat in 'housecat'
451 $x =~ /\bcat/; # matches cat in 'catenates'
452 $x =~ /cat\b/; # matches cat in 'housecat'
453 $x =~ /\bcat\b/; # matches 'cat' at end of string
454
455Note in the last example, the end of the string is considered a word
456boundary.
457
458You might wonder why C<'.'> matches everything but C<"\n"> - why not
459every character? The reason is that often one is matching against
460lines and would like to ignore the newline characters. For instance,
461while the string C<"\n"> represents one line, we would like to think
462of it as empty. Then
463
464 "" =~ /^$/; # matches
465 "\n" =~ /^$/; # matches, $ anchors before "\n"
466
467 "" =~ /./; # doesn't match; it needs a char
468 "" =~ /^.$/; # doesn't match; it needs a char
469 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
470 "a" =~ /^.$/; # matches
471 "a\n" =~ /^.$/; # matches, $ anchors before "\n"
472
473This behavior is convenient, because we usually want to ignore
474newlines when we count and match characters in a line. Sometimes,
475however, we want to keep track of newlines. We might even want C<^>
476and C<$> to anchor at the beginning and end of lines within the
477string, rather than just the beginning and end of the string. Perl
478allows us to choose between ignoring and paying attention to newlines
479by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
480single line and multi-line and they determine whether a string is to
481be treated as one continuous string, or as a set of lines. The two
482modifiers affect two aspects of how the regexp is interpreted: 1) how
483the C<'.'> character class is defined, and 2) where the anchors C<^>
484and C<$> are able to match. Here are the four possible combinations:
485
486=over 4
487
488=item *
489
490no modifiers (//): Default behavior. C<'.'> matches any character
491except C<"\n">. C<^> matches only at the beginning of the string and
492C<$> matches only at the end or before a newline at the end.
493
494=item *
495
496s modifier (//s): Treat string as a single long line. C<'.'> matches
497any character, even C<"\n">. C<^> matches only at the beginning of
498the string and C<$> matches only at the end or before a newline at the
499end.
500
501=item *
502
503m modifier (//m): Treat string as a set of multiple lines. C<'.'>
504matches any character except C<"\n">. C<^> and C<$> are able to match
505at the start or end of I<any> line within the string.
506
507=item *
508
509both s and m modifiers (//sm): Treat string as a single long line, but
510detect multiple lines. C<'.'> matches any character, even
511C<"\n">. C<^> and C<$>, however, are able to match at the start or end
512of I<any> line within the string.
513
514=back
515
516Here are examples of C<//s> and C<//m> in action:
517
518 $x = "There once was a girl\nWho programmed in Perl\n";
519
520 $x =~ /^Who/; # doesn't match, "Who" not at start of string
521 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
522 $x =~ /^Who/m; # matches, "Who" at start of second line
523 $x =~ /^Who/sm; # matches, "Who" at start of second line
524
525 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
526 $x =~ /girl.Who/s; # matches, "." matches "\n"
527 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
528 $x =~ /girl.Who/sm; # matches, "." matches "\n"
529
530Most of the time, the default behavior is what is wanted, but C<//s> and
531C<//m> are occasionally very useful. If C<//m> is being used, the start
532of the string can still be matched with C<\A> and the end of the string
533can still be matched with the anchors C<\Z> (matches both the end and
534the newline before, like C<$>), and C<\z> (matches only the end):
535
536 $x =~ /^Who/m; # matches, "Who" at start of second line
537 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
538
539 $x =~ /girl$/m; # matches, "girl" at end of first line
540 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
541
542 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
543 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
544
545We now know how to create choices among classes of characters in a
546regexp. What about choices among words or character strings? Such
547choices are described in the next section.
548
549=head2 Matching this or that
550
551Sometimes we would like our regexp to be able to match different
552possible words or character strings. This is accomplished by using
553the I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
554form the regexp C<dog|cat>. As before, Perl will try to match the
555regexp at the earliest possible point in the string. At each
556character position, Perl will first try to match the first
557alternative, C<dog>. If C<dog> doesn't match, Perl will then try the
558next alternative, C<cat>. If C<cat> doesn't match either, then the
559match fails and Perl moves to the next position in the string. Some
560examples:
561
562 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
563 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
564
565Even though C<dog> is the first alternative in the second regexp,
566C<cat> is able to match earlier in the string.
567
568 "cats" =~ /c|ca|cat|cats/; # matches "c"
569 "cats" =~ /cats|cat|ca|c/; # matches "cats"
570
571Here, all the alternatives match at the first string position, so the
572first alternative is the one that matches. If some of the
573alternatives are truncations of the others, put the longest ones first
574to give them a chance to match.
575
576 "cab" =~ /a|b|c/ # matches "c"
577 # /a|b|c/ == /[abc]/
578
579The last example points out that character classes are like
580alternations of characters. At a given character position, the first
581alternative that allows the regexp match to succeed will be the one
582that matches.
583
584=head2 Grouping things and hierarchical matching
585
586Alternation allows a regexp to choose among alternatives, but by
587itself it is unsatisfying. The reason is that each alternative is a whole
588regexp, but sometime we want alternatives for just part of a
589regexp. For instance, suppose we want to search for housecats or
590housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
591inefficient because we had to type C<house> twice. It would be nice to
592have parts of the regexp be constant, like C<house>, and some
593parts have alternatives, like C<cat|keeper>.
594
595The I<grouping> metacharacters C<()> solve this problem. Grouping
596allows parts of a regexp to be treated as a single unit. Parts of a
597regexp are grouped by enclosing them in parentheses. Thus we could solve
598the C<housecat|housekeeper> by forming the regexp as
599C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
600C<house> followed by either C<cat> or C<keeper>. Some more examples
601are
602
603 /(a|b)b/; # matches 'ab' or 'bb'
604 /(ac|b)b/; # matches 'acb' or 'bb'
605 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
606 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
607
608 /house(cat|)/; # matches either 'housecat' or 'house'
609 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
610 # 'house'. Note groups can be nested.
611
612 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
613 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
614 # because '20\d\d' can't match
615
616Alternations behave the same way in groups as out of them: at a given
617string position, the leftmost alternative that allows the regexp to
618match is taken. So in the last example at the first string position,
619C<"20"> matches the second alternative, but there is nothing left over
620to match the next two digits C<\d\d>. So Perl moves on to the next
621alternative, which is the null alternative and that works, since
622C<"20"> is two digits.
623
624The process of trying one alternative, seeing if it matches, and
625moving on to the next alternative, while going back in the string
626from where the previous alternative was tried, if it doesn't, is called
627I<backtracking>. The term 'backtracking' comes from the idea that
628matching a regexp is like a walk in the woods. Successfully matching
629a regexp is like arriving at a destination. There are many possible
630trailheads, one for each string position, and each one is tried in
631order, left to right. From each trailhead there may be many paths,
632some of which get you there, and some which are dead ends. When you
633walk along a trail and hit a dead end, you have to backtrack along the
634trail to an earlier point to try another trail. If you hit your
635destination, you stop immediately and forget about trying all the
636other trails. You are persistent, and only if you have tried all the
637trails from all the trailheads and not arrived at your destination, do
638you declare failure. To be concrete, here is a step-by-step analysis
639of what Perl does when it tries to match the regexp
640
641 "abcde" =~ /(abd|abc)(df|d|de)/;
642
643=over 4
644
645=item Z<>0
646
647Start with the first letter in the string 'a'.
648
649=item Z<>1
650
651Try the first alternative in the first group 'abd'.
652
653=item Z<>2
654
655Match 'a' followed by 'b'. So far so good.
656
657=item Z<>3
658
659'd' in the regexp doesn't match 'c' in the string - a dead
660end. So backtrack two characters and pick the second alternative in
661the first group 'abc'.
662
663=item Z<>4
664
665Match 'a' followed by 'b' followed by 'c'. We are on a roll
666and have satisfied the first group. Set $1 to 'abc'.
667
668=item Z<>5
669
670Move on to the second group and pick the first alternative
671'df'.
672
673=item Z<>6
674
675Match the 'd'.
676
677=item Z<>7
678
679'f' in the regexp doesn't match 'e' in the string, so a dead
680end. Backtrack one character and pick the second alternative in the
681second group 'd'.
682
683=item Z<>8
684
685'd' matches. The second grouping is satisfied, so set $2 to
686'd'.
687
688=item Z<>9
689
690We are at the end of the regexp, so we are done! We have
691matched 'abcd' out of the string "abcde".
692
693=back
694
695There are a couple of things to note about this analysis. First, the
696third alternative in the second group 'de' also allows a match, but we
697stopped before we got to it - at a given character position, leftmost
698wins. Second, we were able to get a match at the first character
699position of the string 'a'. If there were no matches at the first
700position, Perl would move to the second character position 'b' and
701attempt the match all over again. Only when all possible paths at all
702possible character positions have been exhausted does Perl give
703up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false.
704
705Even with all this work, regexp matching happens remarkably fast. To
706speed things up, Perl compiles the regexp into a compact sequence of
707opcodes that can often fit inside a processor cache. When the code is
708executed, these opcodes can then run at full throttle and search very
709quickly.
710
711=head2 Extracting matches
712
713The grouping metacharacters C<()> also serve another completely
714different function: they allow the extraction of the parts of a string
715that matched. This is very useful to find out what matched and for
716text processing in general. For each grouping, the part that matched
717inside goes into the special variables C<$1>, C<$2>, etc. They can be
718used just as ordinary variables:
719
720 # extract hours, minutes, seconds
721 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
722 $hours = $1;
723 $minutes = $2;
724 $seconds = $3;
725 }
726
727Now, we know that in scalar context,
728S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false
729value. In list context, however, it returns the list of matched values
730C<($1,$2,$3)>. So we could write the code more compactly as
731
732 # extract hours, minutes, seconds
733 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
734
735If the groupings in a regexp are nested, C<$1> gets the group with the
736leftmost opening parenthesis, C<$2> the next opening parenthesis,
737etc. Here is a regexp with nested groups:
738
739 /(ab(cd|ef)((gi)|j))/;
740 1 2 34
741
742If this regexp matches, C<$1> contains a string starting with
743C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either
744C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>,
745or it remains undefined.
746
747For convenience, Perl sets C<$+> to the string held by the highest numbered
748C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the
749value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>,
750C<$2>,... associated with the rightmost closing parenthesis used in the
751match).
752
753
754=head2 Backreferences
755
756Closely associated with the matching variables C<$1>, C<$2>, ... are
757the I<backreferences> C<\g1>, C<\g2>,... Backreferences are simply
758matching variables that can be used I<inside> a regexp. This is a
759really nice feature; what matches later in a regexp is made to depend on
760what matched earlier in the regexp. Suppose we wanted to look
761for doubled words in a text, like 'the the'. The following regexp finds
762all 3-letter doubles with a space in between:
763
764 /\b(\w\w\w)\s\g1\b/;
765
766The grouping assigns a value to \g1, so that the same 3-letter sequence
767is used for both parts.
768
769A similar task is to find words consisting of two identical parts:
770
771 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
772 beriberi
773 booboo
774 coco
775 mama
776 murmur
777 papa
778
779The regexp has a single grouping which considers 4-letter
780combinations, then 3-letter combinations, etc., and uses C<\g1> to look for
781a repeat. Although C<$1> and C<\g1> represent the same thing, care should be
782taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp
783and backreferences C<\g1>, C<\g2>,... only I<inside> a regexp; not doing
784so may lead to surprising and unsatisfactory results.
785
786
787=head2 Relative backreferences
788
789Counting the opening parentheses to get the correct number for a
790backreference is error-prone as soon as there is more than one
791capturing group. A more convenient technique became available
792with Perl 5.10: relative backreferences. To refer to the immediately
793preceding capture group one now may write C<\g{-1}>, the next but
794last is available via C<\g{-2}>, and so on.
795
796Another good reason in addition to readability and maintainability
797for using relative backreferences is illustrated by the following example,
798where a simple pattern for matching peculiar strings is used:
799
800 $a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.
801
802Now that we have this pattern stored as a handy string, we might feel
803tempted to use it as a part of some other pattern:
804
805 $line = "code=e99e";
806 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
807 print "$1 is valid\n";
808 } else {
809 print "bad line: '$line'\n";
810 }
811
812But this doesn't match, at least not the way one might expect. Only
813after inserting the interpolated C<$a99a> and looking at the resulting
814full text of the regexp is it obvious that the backreferences have
815backfired. The subexpression C<(\w+)> has snatched number 1 and
816demoted the groups in C<$a99a> by one rank. This can be avoided by
817using relative backreferences:
818
819 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
820
821
822=head2 Named backreferences
823
824Perl 5.10 also introduced named capture groups and named backreferences.
825To attach a name to a capturing group, you write either
826C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may
827then be written as C<\g{name}>. It is permissible to attach the
828same name to more than one group, but then only the leftmost one of the
829eponymous set can be referenced. Outside of the pattern a named
830capture group is accessible through the C<%+> hash.
831
832Assuming that we have to match calendar dates which may be given in one
833of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
834three suitable patterns where we use 'd', 'm' and 'y' respectively as the
835names of the groups capturing the pertaining components of a date. The
836matching operation combines the three patterns as alternatives:
837
838 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
839 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
840 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
841 for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
842 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
843 print "day=$+{d} month=$+{m} year=$+{y}\n";
844 }
845 }
846
847If any of the alternatives matches, the hash C<%+> is bound to contain the
848three key-value pairs.
849
850
851=head2 Alternative capture group numbering
852
853Yet another capturing group numbering technique (also as from Perl 5.10)
854deals with the problem of referring to groups within a set of alternatives.
855Consider a pattern for matching a time of the day, civil or military style:
856
857 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
858 # process hour and minute
859 }
860
861Processing the results requires an additional if statement to determine
862whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would
863be easier if we could use group numbers 1 and 2 in second alternative as
864well, and this is exactly what the parenthesized construct C<(?|...)>,
865set around an alternative achieves. Here is an extended version of the
866previous pattern:
867
868 if($time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/){
869 print "hour=$1 minute=$2 zone=$3\n";
870 }
871
872Within the alternative numbering group, group numbers start at the same
873position for each alternative. After the group, numbering continues
874with one higher than the maximum reached across all the alternatives.
875
876=head2 Position information
877
878In addition to what was matched, Perl also provides the
879positions of what was matched as contents of the C<@-> and C<@+>
880arrays. C<$-[0]> is the position of the start of the entire match and
881C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
882position of the start of the C<$n> match and C<$+[n]> is the position
883of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
884this code
885
886 $x = "Mmm...donut, thought Homer";
887 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
888 foreach $exp (1..$#-) {
889 print "Match $exp: '${$exp}' at position ($-[$exp],$+[$exp])\n";
890 }
891
892prints
893
894 Match 1: 'Mmm' at position (0,3)
895 Match 2: 'donut' at position (6,11)
896
897Even if there are no groupings in a regexp, it is still possible to
898find out what exactly matched in a string. If you use them, Perl
899will set C<$`> to the part of the string before the match, will set C<$&>
900to the part of the string that matched, and will set C<$'> to the part
901of the string after the match. An example:
902
903 $x = "the cat caught the mouse";
904 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
905 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
906
907In the second match, C<$`> equals C<''> because the regexp matched at the
908first character position in the string and stopped; it never saw the
909second 'the'.
910
911If your code is to run on Perl versions earlier than
9125.20, it is worthwhile to note that using C<$`> and C<$'>
913slows down regexp matching quite a bit, while C<$&> slows it down to a
914lesser extent, because if they are used in one regexp in a program,
915they are generated for I<all> regexps in the program. So if raw
916performance is a goal of your application, they should be avoided.
917If you need to extract the corresponding substrings, use C<@-> and
918C<@+> instead:
919
920 $` is the same as substr( $x, 0, $-[0] )
921 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
922 $' is the same as substr( $x, $+[0] )
923
924As of Perl 5.10, the C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}>
925variables may be used. These are only set if the C</p> modifier is
926present. Consequently they do not penalize the rest of the program. In
927Perl 5.20, C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}> are available
928whether the C</p> has been used or not (the modifier is ignored), and
929C<$`>, C<$'> and C<$&> do not cause any speed difference.
930
931=head2 Non-capturing groupings
932
933A group that is required to bundle a set of alternatives may or may not be
934useful as a capturing group. If it isn't, it just creates a superfluous
935addition to the set of available capture group values, inside as well as
936outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>,
937still allow the regexp to be treated as a single unit, but don't establish
938a capturing group at the same time. Both capturing and non-capturing
939groupings are allowed to co-exist in the same regexp. Because there is
940no extraction, non-capturing groupings are faster than capturing
941groupings. Non-capturing groupings are also handy for choosing exactly
942which parts of a regexp are to be extracted to matching variables:
943
944 # match a number, $1-$4 are set, but we only want $1
945 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
946
947 # match a number faster , only $1 is set
948 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
949
950 # match a number, get $1 = whole number, $2 = exponent
951 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
952
953Non-capturing groupings are also useful for removing nuisance
954elements gathered from a split operation where parentheses are
955required for some reason:
956
957 $x = '12aba34ba5';
958 @num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
959 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
960
961
962=head2 Matching repetitions
963
964The examples in the previous section display an annoying weakness. We
965were only matching 3-letter words, or chunks of words of 4 letters or
966less. We'd like to be able to match words or, more generally, strings
967of any length, without writing out tedious alternatives like
968C<\w\w\w\w|\w\w\w|\w\w|\w>.
969
970This is exactly the problem the I<quantifier> metacharacters C<?>,
971C<*>, C<+>, and C<{}> were created for. They allow us to delimit the
972number of repeats for a portion of a regexp we consider to be a
973match. Quantifiers are put immediately after the character, character
974class, or grouping that we want to specify. They have the following
975meanings:
976
977=over 4
978
979=item *
980
981C<a?> means: match 'a' 1 or 0 times
982
983=item *
984
985C<a*> means: match 'a' 0 or more times, i.e., any number of times
986
987=item *
988
989C<a+> means: match 'a' 1 or more times, i.e., at least once
990
991=item *
992
993C<a{n,m}> means: match at least C<n> times, but not more than C<m>
994times.
995
996=item *
997
998C<a{n,}> means: match at least C<n> or more times
999
1000=item *
1001
1002C<a{n}> means: match exactly C<n> times
1003
1004=back
1005
1006Here are some examples:
1007
1008 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
1009 # any number of digits
1010 /(\w+)\s+\g1/; # match doubled words of arbitrary length
1011 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
1012 $year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
1013 # than 4 digits
1014 $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
1015 $year =~ /^\d{2}(\d{2})?$/; # same thing written differently.
1016 # However, this captures the last two
1017 # digits in $1 and the other does not.
1018
1019 % simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
1020 beriberi
1021 booboo
1022 coco
1023 mama
1024 murmur
1025 papa
1026
1027For all of these quantifiers, Perl will try to match as much of the
1028string as possible, while still allowing the regexp to succeed. Thus
1029with C</a?.../>, Perl will first try to match the regexp with the C<a>
1030present; if that fails, Perl will try to match the regexp without the
1031C<a> present. For the quantifier C<*>, we get the following:
1032
1033 $x = "the cat in the hat";
1034 $x =~ /^(.*)(cat)(.*)$/; # matches,
1035 # $1 = 'the '
1036 # $2 = 'cat'
1037 # $3 = ' in the hat'
1038
1039Which is what we might expect, the match finds the only C<cat> in the
1040string and locks onto it. Consider, however, this regexp:
1041
1042 $x =~ /^(.*)(at)(.*)$/; # matches,
1043 # $1 = 'the cat in the h'
1044 # $2 = 'at'
1045 # $3 = '' (0 characters match)
1046
1047One might initially guess that Perl would find the C<at> in C<cat> and
1048stop there, but that wouldn't give the longest possible string to the
1049first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
1050much of the string as possible while still having the regexp match. In
1051this example, that means having the C<at> sequence with the final C<at>
1052in the string. The other important principle illustrated here is that,
1053when there are two or more elements in a regexp, the I<leftmost>
1054quantifier, if there is one, gets to grab as much of the string as
1055possible, leaving the rest of the regexp to fight over scraps. Thus in
1056our example, the first quantifier C<.*> grabs most of the string, while
1057the second quantifier C<.*> gets the empty string. Quantifiers that
1058grab as much of the string as possible are called I<maximal match> or
1059I<greedy> quantifiers.
1060
1061When a regexp can match a string in several different ways, we can use
1062the principles above to predict which way the regexp will match:
1063
1064=over 4
1065
1066=item *
1067
1068Principle 0: Taken as a whole, any regexp will be matched at the
1069earliest possible position in the string.
1070
1071=item *
1072
1073Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
1074that allows a match for the whole regexp will be the one used.
1075
1076=item *
1077
1078Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
1079C<{n,m}> will in general match as much of the string as possible while
1080still allowing the whole regexp to match.
1081
1082=item *
1083
1084Principle 3: If there are two or more elements in a regexp, the
1085leftmost greedy quantifier, if any, will match as much of the string
1086as possible while still allowing the whole regexp to match. The next
1087leftmost greedy quantifier, if any, will try to match as much of the
1088string remaining available to it as possible, while still allowing the
1089whole regexp to match. And so on, until all the regexp elements are
1090satisfied.
1091
1092=back
1093
1094As we have seen above, Principle 0 overrides the others. The regexp
1095will be matched as early as possible, with the other principles
1096determining how the regexp matches at that earliest character
1097position.
1098
1099Here is an example of these principles in action:
1100
1101 $x = "The programming republic of Perl";
1102 $x =~ /^(.+)(e|r)(.*)$/; # matches,
1103 # $1 = 'The programming republic of Pe'
1104 # $2 = 'r'
1105 # $3 = 'l'
1106
1107This regexp matches at the earliest string position, C<'T'>. One
1108might think that C<e>, being leftmost in the alternation, would be
1109matched, but C<r> produces the longest string in the first quantifier.
1110
1111 $x =~ /(m{1,2})(.*)$/; # matches,
1112 # $1 = 'mm'
1113 # $2 = 'ing republic of Perl'
1114
1115Here, The earliest possible match is at the first C<'m'> in
1116C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
1117a maximal C<mm>.
1118
1119 $x =~ /.*(m{1,2})(.*)$/; # matches,
1120 # $1 = 'm'
1121 # $2 = 'ing republic of Perl'
1122
1123Here, the regexp matches at the start of the string. The first
1124quantifier C<.*> grabs as much as possible, leaving just a single
1125C<'m'> for the second quantifier C<m{1,2}>.
1126
1127 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
1128 # $1 = 'a'
1129 # $2 = 'mm'
1130 # $3 = 'ing republic of Perl'
1131
1132Here, C<.?> eats its maximal one character at the earliest possible
1133position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
1134the opportunity to match both C<m>'s. Finally,
1135
1136 "aXXXb" =~ /(X*)/; # matches with $1 = ''
1137
1138because it can match zero copies of C<'X'> at the beginning of the
1139string. If you definitely want to match at least one C<'X'>, use
1140C<X+>, not C<X*>.
1141
1142Sometimes greed is not good. At times, we would like quantifiers to
1143match a I<minimal> piece of string, rather than a maximal piece. For
1144this purpose, Larry Wall created the I<minimal match> or
1145I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are
1146the usual quantifiers with a C<?> appended to them. They have the
1147following meanings:
1148
1149=over 4
1150
1151=item *
1152
1153C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1.
1154
1155=item *
1156
1157C<a*?> means: match 'a' 0 or more times, i.e., any number of times,
1158but as few times as possible
1159
1160=item *
1161
1162C<a+?> means: match 'a' 1 or more times, i.e., at least once, but
1163as few times as possible
1164
1165=item *
1166
1167C<a{n,m}?> means: match at least C<n> times, not more than C<m>
1168times, as few times as possible
1169
1170=item *
1171
1172C<a{n,}?> means: match at least C<n> times, but as few times as
1173possible
1174
1175=item *
1176
1177C<a{n}?> means: match exactly C<n> times. Because we match exactly
1178C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1179notational consistency.
1180
1181=back
1182
1183Let's look at the example above, but with minimal quantifiers:
1184
1185 $x = "The programming republic of Perl";
1186 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1187 # $1 = 'Th'
1188 # $2 = 'e'
1189 # $3 = ' programming republic of Perl'
1190
1191The minimal string that will allow both the start of the string C<^>
1192and the alternation to match is C<Th>, with the alternation C<e|r>
1193matching C<e>. The second quantifier C<.*> is free to gobble up the
1194rest of the string.
1195
1196 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1197 # $1 = 'm'
1198 # $2 = 'ming republic of Perl'
1199
1200The first string position that this regexp can match is at the first
1201C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1202matches just one C<'m'>. Although the second quantifier C<.*?> would
1203prefer to match no characters, it is constrained by the end-of-string
1204anchor C<$> to match the rest of the string.
1205
1206 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1207 # $1 = 'The progra'
1208 # $2 = 'm'
1209 # $3 = 'ming republic of Perl'
1210
1211In this regexp, you might expect the first minimal quantifier C<.*?>
1212to match the empty string, because it is not constrained by a C<^>
1213anchor to match the beginning of the word. Principle 0 applies here,
1214however. Because it is possible for the whole regexp to match at the
1215start of the string, it I<will> match at the start of the string. Thus
1216the first quantifier has to match everything up to the first C<m>. The
1217second minimal quantifier matches just one C<m> and the third
1218quantifier matches the rest of the string.
1219
1220 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1221 # $1 = 'a'
1222 # $2 = 'mm'
1223 # $3 = 'ing republic of Perl'
1224
1225Just as in the previous regexp, the first quantifier C<.??> can match
1226earliest at position C<'a'>, so it does. The second quantifier is
1227greedy, so it matches C<mm>, and the third matches the rest of the
1228string.
1229
1230We can modify principle 3 above to take into account non-greedy
1231quantifiers:
1232
1233=over 4
1234
1235=item *
1236
1237Principle 3: If there are two or more elements in a regexp, the
1238leftmost greedy (non-greedy) quantifier, if any, will match as much
1239(little) of the string as possible while still allowing the whole
1240regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1241any, will try to match as much (little) of the string remaining
1242available to it as possible, while still allowing the whole regexp to
1243match. And so on, until all the regexp elements are satisfied.
1244
1245=back
1246
1247Just like alternation, quantifiers are also susceptible to
1248backtracking. Here is a step-by-step analysis of the example
1249
1250 $x = "the cat in the hat";
1251 $x =~ /^(.*)(at)(.*)$/; # matches,
1252 # $1 = 'the cat in the h'
1253 # $2 = 'at'
1254 # $3 = '' (0 matches)
1255
1256=over 4
1257
1258=item Z<>0
1259
1260Start with the first letter in the string 't'.
1261
1262=item Z<>1
1263
1264The first quantifier '.*' starts out by matching the whole
1265string 'the cat in the hat'.
1266
1267=item Z<>2
1268
1269'a' in the regexp element 'at' doesn't match the end of the
1270string. Backtrack one character.
1271
1272=item Z<>3
1273
1274'a' in the regexp element 'at' still doesn't match the last
1275letter of the string 't', so backtrack one more character.
1276
1277=item Z<>4
1278
1279Now we can match the 'a' and the 't'.
1280
1281=item Z<>5
1282
1283Move on to the third element '.*'. Since we are at the end of
1284the string and '.*' can match 0 times, assign it the empty string.
1285
1286=item Z<>6
1287
1288We are done!
1289
1290=back
1291
1292Most of the time, all this moving forward and backtracking happens
1293quickly and searching is fast. There are some pathological regexps,
1294however, whose execution time exponentially grows with the size of the
1295string. A typical structure that blows up in your face is of the form
1296
1297 /(a|b+)*/;
1298
1299The problem is the nested indeterminate quantifiers. There are many
1300different ways of partitioning a string of length n between the C<+>
1301and C<*>: one repetition with C<b+> of length n, two repetitions with
1302the first C<b+> length k and the second with length n-k, m repetitions
1303whose bits add up to length n, etc. In fact there are an exponential
1304number of ways to partition a string as a function of its length. A
1305regexp may get lucky and match early in the process, but if there is
1306no match, Perl will try I<every> possibility before giving up. So be
1307careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
1308I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful
1309discussion of this and other efficiency issues.
1310
1311
1312=head2 Possessive quantifiers
1313
1314Backtracking during the relentless search for a match may be a waste
1315of time, particularly when the match is bound to fail. Consider
1316the simple pattern
1317
1318 /^\w+\s+\w+$/; # a word, spaces, a word
1319
1320Whenever this is applied to a string which doesn't quite meet the
1321pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>,
1322the regex engine will backtrack, approximately once for each character
1323in the string. But we know that there is no way around taking I<all>
1324of the initial word characters to match the first repetition, that I<all>
1325spaces must be eaten by the middle part, and the same goes for the second
1326word.
1327
1328With the introduction of the I<possessive quantifiers> in Perl 5.10, we
1329have a way of instructing the regex engine not to backtrack, with the
1330usual quantifiers with a C<+> appended to them. This makes them greedy as
1331well as stingy; once they succeed they won't give anything back to permit
1332another solution. They have the following meanings:
1333
1334=over 4
1335
1336=item *
1337
1338C<a{n,m}+> means: match at least C<n> times, not more than C<m> times,
1339as many times as possible, and don't give anything up. C<a?+> is short
1340for C<a{0,1}+>
1341
1342=item *
1343
1344C<a{n,}+> means: match at least C<n> times, but as many times as possible,
1345and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is
1346short for C<a{1,}+>.
1347
1348=item *
1349
1350C<a{n}+> means: match exactly C<n> times. It is just there for
1351notational consistency.
1352
1353=back
1354
1355These possessive quantifiers represent a special case of a more general
1356concept, the I<independent subexpression>, see below.
1357
1358As an example where a possessive quantifier is suitable we consider
1359matching a quoted string, as it appears in several programming languages.
1360The backslash is used as an escape character that indicates that the
1361next character is to be taken literally, as another character for the
1362string. Therefore, after the opening quote, we expect a (possibly
1363empty) sequence of alternatives: either some character except an
1364unescaped quote or backslash or an escaped character.
1365
1366 /"(?:[^"\\]++|\\.)*+"/;
1367
1368
1369=head2 Building a regexp
1370
1371At this point, we have all the basic regexp concepts covered, so let's
1372give a more involved example of a regular expression. We will build a
1373regexp that matches numbers.
1374
1375The first task in building a regexp is to decide what we want to match
1376and what we want to exclude. In our case, we want to match both
1377integers and floating point numbers and we want to reject any string
1378that isn't a number.
1379
1380The next task is to break the problem down into smaller problems that
1381are easily converted into a regexp.
1382
1383The simplest case is integers. These consist of a sequence of digits,
1384with an optional sign in front. The digits we can represent with
1385C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1386regexp is
1387
1388 /[+-]?\d+/; # matches integers
1389
1390A floating point number potentially has a sign, an integral part, a
1391decimal point, a fractional part, and an exponent. One or more of these
1392parts is optional, so we need to check out the different
1393possibilities. Floating point numbers which are in proper form include
1394123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1395front is completely optional and can be matched by C<[+-]?>. We can
1396see that if there is no exponent, floating point numbers must have a
1397decimal point, otherwise they are integers. We might be tempted to
1398model these with C<\d*\.\d*>, but this would also match just a single
1399decimal point, which is not a number. So the three cases of floating
1400point number without exponent are
1401
1402 /[+-]?\d+\./; # 1., 321., etc.
1403 /[+-]?\.\d+/; # .1, .234, etc.
1404 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1405
1406These can be combined into a single regexp with a three-way alternation:
1407
1408 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1409
1410In this alternation, it is important to put C<'\d+\.\d+'> before
1411C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1412and ignore the fractional part of the number.
1413
1414Now consider floating point numbers with exponents. The key
1415observation here is that I<both> integers and numbers with decimal
1416points are allowed in front of an exponent. Then exponents, like the
1417overall sign, are independent of whether we are matching numbers with
1418or without decimal points, and can be 'decoupled' from the
1419mantissa. The overall form of the regexp now becomes clear:
1420
1421 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1422
1423The exponent is an C<e> or C<E>, followed by an integer. So the
1424exponent regexp is
1425
1426 /[eE][+-]?\d+/; # exponent
1427
1428Putting all the parts together, we get a regexp that matches numbers:
1429
1430 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1431
1432Long regexps like this may impress your friends, but can be hard to
1433decipher. In complex situations like this, the C<//x> modifier for a
1434match is invaluable. It allows one to put nearly arbitrary whitespace
1435and comments into a regexp without affecting their meaning. Using it,
1436we can rewrite our 'extended' regexp in the more pleasing form
1437
1438 /^
1439 [+-]? # first, match an optional sign
1440 ( # then match integers or f.p. mantissas:
1441 \d+\.\d+ # mantissa of the form a.b
1442 |\d+\. # mantissa of the form a.
1443 |\.\d+ # mantissa of the form .b
1444 |\d+ # integer of the form a
1445 )
1446 ([eE][+-]?\d+)? # finally, optionally match an exponent
1447 $/x;
1448
1449If whitespace is mostly irrelevant, how does one include space
1450characters in an extended regexp? The answer is to backslash it
1451S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing
1452goes for pound signs: use C<\#> or C<[#]>. For instance, Perl allows
1453a space between the sign and the mantissa or integer, and we could add
1454this to our regexp as follows:
1455
1456 /^
1457 [+-]?\ * # first, match an optional sign *and space*
1458 ( # then match integers or f.p. mantissas:
1459 \d+\.\d+ # mantissa of the form a.b
1460 |\d+\. # mantissa of the form a.
1461 |\.\d+ # mantissa of the form .b
1462 |\d+ # integer of the form a
1463 )
1464 ([eE][+-]?\d+)? # finally, optionally match an exponent
1465 $/x;
1466
1467In this form, it is easier to see a way to simplify the
1468alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1469could be factored out:
1470
1471 /^
1472 [+-]?\ * # first, match an optional sign
1473 ( # then match integers or f.p. mantissas:
1474 \d+ # start out with a ...
1475 (
1476 \.\d* # mantissa of the form a.b or a.
1477 )? # ? takes care of integers of the form a
1478 |\.\d+ # mantissa of the form .b
1479 )
1480 ([eE][+-]?\d+)? # finally, optionally match an exponent
1481 $/x;
1482
1483or written in the compact form,
1484
1485 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1486
1487This is our final regexp. To recap, we built a regexp by
1488
1489=over 4
1490
1491=item *
1492
1493specifying the task in detail,
1494
1495=item *
1496
1497breaking down the problem into smaller parts,
1498
1499=item *
1500
1501translating the small parts into regexps,
1502
1503=item *
1504
1505combining the regexps,
1506
1507=item *
1508
1509and optimizing the final combined regexp.
1510
1511=back
1512
1513These are also the typical steps involved in writing a computer
1514program. This makes perfect sense, because regular expressions are
1515essentially programs written in a little computer language that specifies
1516patterns.
1517
1518=head2 Using regular expressions in Perl
1519
1520The last topic of Part 1 briefly covers how regexps are used in Perl
1521programs. Where do they fit into Perl syntax?
1522
1523We have already introduced the matching operator in its default
1524C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1525the binding operator C<=~> and its negation C<!~> to test for string
1526matches. Associated with the matching operator, we have discussed the
1527single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
1528extended C<//x> modifiers. There are a few more things you might
1529want to know about matching operators.
1530
1531=head3 Prohibiting substitution
1532
1533If you change C<$pattern> after the first substitution happens, Perl
1534will ignore it. If you don't want any substitutions at all, use the
1535special delimiter C<m''>:
1536
1537 @pattern = ('Seuss');
1538 while (<>) {
1539 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
1540 }
1541
1542Similar to strings, C<m''> acts like apostrophes on a regexp; all other
1543C<m> delimiters act like quotes. If the regexp evaluates to the empty string,
1544the regexp in the I<last successful match> is used instead. So we have
1545
1546 "dog" =~ /d/; # 'd' matches
1547 "dogbert =~ //; # this matches the 'd' regexp used before
1548
1549
1550=head3 Global matching
1551
1552The final two modifiers we will discuss here,
1553C<//g> and C<//c>, concern multiple matches.
1554The modifier C<//g> stands for global matching and allows the
1555matching operator to match within a string as many times as possible.
1556In scalar context, successive invocations against a string will have
1557C<//g> jump from match to match, keeping track of position in the
1558string as it goes along. You can get or set the position with the
1559C<pos()> function.
1560
1561The use of C<//g> is shown in the following example. Suppose we have
1562a string that consists of words separated by spaces. If we know how
1563many words there are in advance, we could extract the words using
1564groupings:
1565
1566 $x = "cat dog house"; # 3 words
1567 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1568 # $1 = 'cat'
1569 # $2 = 'dog'
1570 # $3 = 'house'
1571
1572But what if we had an indeterminate number of words? This is the sort
1573of task C<//g> was made for. To extract all words, form the simple
1574regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1575
1576 while ($x =~ /(\w+)/g) {
1577 print "Word is $1, ends at position ", pos $x, "\n";
1578 }
1579
1580prints
1581
1582 Word is cat, ends at position 3
1583 Word is dog, ends at position 7
1584 Word is house, ends at position 13
1585
1586A failed match or changing the target string resets the position. If
1587you don't want the position reset after failure to match, add the
1588C<//c>, as in C</regexp/gc>. The current position in the string is
1589associated with the string, not the regexp. This means that different
1590strings have different positions and their respective positions can be
1591set or read independently.
1592
1593In list context, C<//g> returns a list of matched groupings, or if
1594there are no groupings, a list of matches to the whole regexp. So if
1595we wanted just the words, we could use
1596
1597 @words = ($x =~ /(\w+)/g); # matches,
1598 # $words[0] = 'cat'
1599 # $words[1] = 'dog'
1600 # $words[2] = 'house'
1601
1602Closely associated with the C<//g> modifier is the C<\G> anchor. The
1603C<\G> anchor matches at the point where the previous C<//g> match left
1604off. C<\G> allows us to easily do context-sensitive matching:
1605
1606 $metric = 1; # use metric units
1607 ...
1608 $x = <FILE>; # read in measurement
1609 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1610 $weight = $1;
1611 if ($metric) { # error checking
1612 print "Units error!" unless $x =~ /\Gkg\./g;
1613 }
1614 else {
1615 print "Units error!" unless $x =~ /\Glbs\./g;
1616 }
1617 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1618
1619The combination of C<//g> and C<\G> allows us to process the string a
1620bit at a time and use arbitrary Perl logic to decide what to do next.
1621Currently, the C<\G> anchor is only fully supported when used to anchor
1622to the start of the pattern.
1623
1624C<\G> is also invaluable in processing fixed-length records with
1625regexps. Suppose we have a snippet of coding region DNA, encoded as
1626base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1627codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1628we can think of the DNA snippet as a sequence of 3-letter records. The
1629naive regexp
1630
1631 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1632 $dna = "ATCGTTGAATGCAAATGACATGAC";
1633 $dna =~ /TGA/;
1634
1635doesn't work; it may match a C<TGA>, but there is no guarantee that
1636the match is aligned with codon boundaries, e.g., the substring
1637S<C<GTT GAA>> gives a match. A better solution is
1638
1639 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1640 print "Got a TGA stop codon at position ", pos $dna, "\n";
1641 }
1642
1643which prints
1644
1645 Got a TGA stop codon at position 18
1646 Got a TGA stop codon at position 23
1647
1648Position 18 is good, but position 23 is bogus. What happened?
1649
1650The answer is that our regexp works well until we get past the last
1651real match. Then the regexp will fail to match a synchronized C<TGA>
1652and start stepping ahead one character position at a time, not what we
1653want. The solution is to use C<\G> to anchor the match to the codon
1654alignment:
1655
1656 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1657 print "Got a TGA stop codon at position ", pos $dna, "\n";
1658 }
1659
1660This prints
1661
1662 Got a TGA stop codon at position 18
1663
1664which is the correct answer. This example illustrates that it is
1665important not only to match what is desired, but to reject what is not
1666desired.
1667
1668(There are other regexp modifiers that are available, such as
1669C<//o>, but their specialized uses are beyond the
1670scope of this introduction. )
1671
1672=head3 Search and replace
1673
1674Regular expressions also play a big role in I<search and replace>
1675operations in Perl. Search and replace is accomplished with the
1676C<s///> operator. The general form is
1677C<s/regexp/replacement/modifiers>, with everything we know about
1678regexps and modifiers applying in this case as well. The
1679C<replacement> is a Perl double-quoted string that replaces in the
1680string whatever is matched with the C<regexp>. The operator C<=~> is
1681also used here to associate a string with C<s///>. If matching
1682against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match,
1683C<s///> returns the number of substitutions made; otherwise it returns
1684false. Here are a few examples:
1685
1686 $x = "Time to feed the cat!";
1687 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1688 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1689 $more_insistent = 1;
1690 }
1691 $y = "'quoted words'";
1692 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1693 # $y contains "quoted words"
1694
1695In the last example, the whole string was matched, but only the part
1696inside the single quotes was grouped. With the C<s///> operator, the
1697matched variables C<$1>, C<$2>, etc. are immediately available for use
1698in the replacement expression, so we use C<$1> to replace the quoted
1699string with just what was quoted. With the global modifier, C<s///g>
1700will search and replace all occurrences of the regexp in the string:
1701
1702 $x = "I batted 4 for 4";
1703 $x =~ s/4/four/; # doesn't do it all:
1704 # $x contains "I batted four for 4"
1705 $x = "I batted 4 for 4";
1706 $x =~ s/4/four/g; # does it all:
1707 # $x contains "I batted four for four"
1708
1709If you prefer 'regex' over 'regexp' in this tutorial, you could use
1710the following program to replace it:
1711
1712 % cat > simple_replace
1713 #!/usr/bin/perl
1714 $regexp = shift;
1715 $replacement = shift;
1716 while (<>) {
1717 s/$regexp/$replacement/g;
1718 print;
1719 }
1720 ^D
1721
1722 % simple_replace regexp regex perlretut.pod
1723
1724In C<simple_replace> we used the C<s///g> modifier to replace all
1725occurrences of the regexp on each line. (Even though the regular
1726expression appears in a loop, Perl is smart enough to compile it
1727only once.) As with C<simple_grep>, both the
1728C<print> and the C<s/$regexp/$replacement/g> use C<$_> implicitly.
1729
1730If you don't want C<s///> to change your original variable you can use
1731the non-destructive substitute modifier, C<s///r>. This changes the
1732behavior so that C<s///r> returns the final substituted string
1733(instead of the number of substitutions):
1734
1735 $x = "I like dogs.";
1736 $y = $x =~ s/dogs/cats/r;
1737 print "$x $y\n";
1738
1739That example will print "I like dogs. I like cats". Notice the original
1740C<$x> variable has not been affected. The overall
1741result of the substitution is instead stored in C<$y>. If the
1742substitution doesn't affect anything then the original string is
1743returned:
1744
1745 $x = "I like dogs.";
1746 $y = $x =~ s/elephants/cougars/r;
1747 print "$x $y\n"; # prints "I like dogs. I like dogs."
1748
1749One other interesting thing that the C<s///r> flag allows is chaining
1750substitutions:
1751
1752 $x = "Cats are great.";
1753 print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~
1754 s/Frogs/Hedgehogs/r, "\n";
1755 # prints "Hedgehogs are great."
1756
1757A modifier available specifically to search and replace is the
1758C<s///e> evaluation modifier. C<s///e> treats the
1759replacement text as Perl code, rather than a double-quoted
1760string. The value that the code returns is substituted for the
1761matched substring. C<s///e> is useful if you need to do a bit of
1762computation in the process of replacing text. This example counts
1763character frequencies in a line:
1764
1765 $x = "Bill the cat";
1766 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1767 print "frequency of '$_' is $chars{$_}\n"
1768 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1769
1770This prints
1771
1772 frequency of ' ' is 2
1773 frequency of 't' is 2
1774 frequency of 'l' is 2
1775 frequency of 'B' is 1
1776 frequency of 'c' is 1
1777 frequency of 'e' is 1
1778 frequency of 'h' is 1
1779 frequency of 'i' is 1
1780 frequency of 'a' is 1
1781
1782As with the match C<m//> operator, C<s///> can use other delimiters,
1783such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1784used C<s'''>, then the regexp and replacement are
1785treated as single-quoted strings and there are no
1786variable substitutions. C<s///> in list context
1787returns the same thing as in scalar context, i.e., the number of
1788matches.
1789
1790=head3 The split function
1791
1792The C<split()> function is another place where a regexp is used.
1793C<split /regexp/, string, limit> separates the C<string> operand into
1794a list of substrings and returns that list. The regexp must be designed
1795to match whatever constitutes the separators for the desired substrings.
1796The C<limit>, if present, constrains splitting into no more than C<limit>
1797number of strings. For example, to split a string into words, use
1798
1799 $x = "Calvin and Hobbes";
1800 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1801 # $word[1] = 'and'
1802 # $word[2] = 'Hobbes'
1803
1804If the empty regexp C<//> is used, the regexp always matches and
1805the string is split into individual characters. If the regexp has
1806groupings, then the resulting list contains the matched substrings from the
1807groupings as well. For instance,
1808
1809 $x = "/usr/bin/perl";
1810 @dirs = split m!/!, $x; # $dirs[0] = ''
1811 # $dirs[1] = 'usr'
1812 # $dirs[2] = 'bin'
1813 # $dirs[3] = 'perl'
1814 @parts = split m!(/)!, $x; # $parts[0] = ''
1815 # $parts[1] = '/'
1816 # $parts[2] = 'usr'
1817 # $parts[3] = '/'
1818 # $parts[4] = 'bin'
1819 # $parts[5] = '/'
1820 # $parts[6] = 'perl'
1821
1822Since the first character of $x matched the regexp, C<split> prepended
1823an empty initial element to the list.
1824
1825If you have read this far, congratulations! You now have all the basic
1826tools needed to use regular expressions to solve a wide range of text
1827processing problems. If this is your first time through the tutorial,
1828why not stop here and play around with regexps a while.... S<Part 2>
1829concerns the more esoteric aspects of regular expressions and those
1830concepts certainly aren't needed right at the start.
1831
1832=head1 Part 2: Power tools
1833
1834OK, you know the basics of regexps and you want to know more. If
1835matching regular expressions is analogous to a walk in the woods, then
1836the tools discussed in Part 1 are analogous to topo maps and a
1837compass, basic tools we use all the time. Most of the tools in part 2
1838are analogous to flare guns and satellite phones. They aren't used
1839too often on a hike, but when we are stuck, they can be invaluable.
1840
1841What follows are the more advanced, less used, or sometimes esoteric
1842capabilities of Perl regexps. In Part 2, we will assume you are
1843comfortable with the basics and concentrate on the advanced features.
1844
1845=head2 More on characters, strings, and character classes
1846
1847There are a number of escape sequences and character classes that we
1848haven't covered yet.
1849
1850There are several escape sequences that convert characters or strings
1851between upper and lower case, and they are also available within
1852patterns. C<\l> and C<\u> convert the next character to lower or
1853upper case, respectively:
1854
1855 $x = "perl";
1856 $string =~ /\u$x/; # matches 'Perl' in $string
1857 $x = "M(rs?|s)\\."; # note the double backslash
1858 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1859
1860A C<\L> or C<\U> indicates a lasting conversion of case, until
1861terminated by C<\E> or thrown over by another C<\U> or C<\L>:
1862
1863 $x = "This word is in lower case:\L SHOUT\E";
1864 $x =~ /shout/; # matches
1865 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1866 $x =~ /\Ukeypunch/; # matches punch card string
1867
1868If there is no C<\E>, case is converted until the end of the
1869string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1870character of C<$word> to uppercase and the rest of the characters to
1871lowercase.
1872
1873Control characters can be escaped with C<\c>, so that a control-Z
1874character would be matched with C<\cZ>. The escape sequence
1875C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1876instance,
1877
1878 $x = "\QThat !^*&%~& cat!";
1879 $x =~ /\Q!^*&%~&\E/; # check for rough language
1880
1881It does not protect C<$> or C<@>, so that variables can still be
1882substituted.
1883
1884C<\Q>, C<\L>, C<\l>, C<\U>, C<\u> and C<\E> are actually part of
1885double-quotish syntax, and not part of regexp syntax proper. They will
1886work if they appear in a regular expression embedded directly in a
1887program, but not when contained in a string that is interpolated in a
1888pattern.
1889
1890Perl regexps can handle more than just the
1891standard ASCII character set. Perl supports I<Unicode>, a standard
1892for representing the alphabets from virtually all of the world's written
1893languages, and a host of symbols. Perl's text strings are Unicode strings, so
1894they can contain characters with a value (codepoint or character number) higher
1895than 255.
1896
1897What does this mean for regexps? Well, regexp users don't need to know
1898much about Perl's internal representation of strings. But they do need
1899to know 1) how to represent Unicode characters in a regexp and 2) that
1900a matching operation will treat the string to be searched as a sequence
1901of characters, not bytes. The answer to 1) is that Unicode characters
1902greater than C<chr(255)> are represented using the C<\x{hex}> notation, because
1903\x hex (without curly braces) doesn't go further than 255. (Starting in Perl
19045.14, if you're an octal fan, you can also use C<\o{oct}>.)
1905
1906 /\x{263a}/; # match a Unicode smiley face :)
1907
1908B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use
1909utf8> to use any Unicode features. This is no more the case: for
1910almost all Unicode processing, the explicit C<utf8> pragma is not
1911needed. (The only case where it matters is if your Perl script is in
1912Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
1913
1914Figuring out the hexadecimal sequence of a Unicode character you want
1915or deciphering someone else's hexadecimal Unicode regexp is about as
1916much fun as programming in machine code. So another way to specify
1917Unicode characters is to use the I<named character> escape
1918sequence C<\N{I<name>}>. I<name> is a name for the Unicode character, as
1919specified in the Unicode standard. For instance, if we wanted to
1920represent or match the astrological sign for the planet Mercury, we
1921could use
1922
1923 $x = "abc\N{MERCURY}def";
1924 $x =~ /\N{MERCURY}/; # matches
1925
1926One can also use "short" names:
1927
1928 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1929 print "\N{greek:Sigma} is an upper-case sigma.\n";
1930
1931You can also restrict names to a certain alphabet by specifying the
1932L<charnames> pragma:
1933
1934 use charnames qw(greek);
1935 print "\N{sigma} is Greek sigma\n";
1936
1937An index of character names is available on-line from the Unicode
1938Consortium, L<http://www.unicode.org/charts/charindex.html>; explanatory
1939material with links to other resources at
1940L<http://www.unicode.org/standard/where>.
1941
1942The answer to requirement 2) is that a regexp (mostly)
1943uses Unicode characters. The "mostly" is for messy backward
1944compatibility reasons, but starting in Perl 5.14, any regex compiled in
1945the scope of a C<use feature 'unicode_strings'> (which is automatically
1946turned on within the scope of a C<use 5.012> or higher) will turn that
1947"mostly" into "always". If you want to handle Unicode properly, you
1948should ensure that C<'unicode_strings'> is turned on.
1949Internally, this is encoded to bytes using either UTF-8 or a native 8
1950bit encoding, depending on the history of the string, but conceptually
1951it is a sequence of characters, not bytes. See L<perlunitut> for a
1952tutorial about that.
1953
1954Let us now discuss Unicode character classes, most usually called
1955"character properties". These are represented by the
1956C<\p{name}> escape sequence. Closely associated is the C<\P{name}>
1957property, which is the negation of the C<\p{name}> one. For
1958example, to match lower and uppercase characters,
1959
1960 $x = "BOB";
1961 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1962 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1963 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1964 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1965
1966(The "Is" is optional.)
1967
1968There are many, many Unicode character properties. For the full list
1969see L<perluniprops>. Most of them have synonyms with shorter names,
1970also listed there. Some synonyms are a single character. For these,
1971you can drop the braces. For instance, C<\pM> is the same thing as
1972C<\p{Mark}>, meaning things like accent marks.
1973
1974The Unicode C<\p{Script}> property is used to categorize every Unicode
1975character into the language script it is written in. For example,
1976English, French, and a bunch of other European languages are written in
1977the Latin script. But there is also the Greek script, the Thai script,
1978the Katakana script, etc. You can test whether a character is in a
1979particular script with, for example C<\p{Latin}>, C<\p{Greek}>,
1980or C<\p{Katakana}>. To test if it isn't in the Balinese script, you
1981would use C<\P{Balinese}>.
1982
1983What we have described so far is the single form of the C<\p{...}> character
1984classes. There is also a compound form which you may run into. These
1985look like C<\p{name=value}> or C<\p{name:value}> (the equals sign and colon
1986can be used interchangeably). These are more general than the single form,
1987and in fact most of the single forms are just Perl-defined shortcuts for common
1988compound forms. For example, the script examples in the previous paragraph
1989could be written equivalently as C<\p{Script=Latin}>, C<\p{Script:Greek}>,
1990C<\p{script=katakana}>, and C<\P{script=balinese}> (case is irrelevant
1991between the C<{}> braces). You may
1992never have to use the compound forms, but sometimes it is necessary, and their
1993use can make your code easier to understand.
1994
1995C<\X> is an abbreviation for a character class that comprises
1996a Unicode I<extended grapheme cluster>. This represents a "logical character":
1997what appears to be a single character, but may be represented internally by more
1998than one. As an example, using the Unicode full names, e.g., S<C<A + COMBINING
1999RING>> is a grapheme cluster with base character C<A> and combining character
2000S<C<COMBINING RING>>, which translates in Danish to A with the circle atop it,
2001as in the word E<Aring>ngstrom.
2002
2003For the full and latest information about Unicode see the latest
2004Unicode standard, or the Unicode Consortium's website L<http://www.unicode.org>
2005
2006As if all those classes weren't enough, Perl also defines POSIX-style
2007character classes. These have the form C<[:name:]>, with C<name> the
2008name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
2009C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
2010C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
2011extension to match C<\w>), and C<blank> (a GNU extension). The C<//a>
2012modifier restricts these to matching just in the ASCII range; otherwise
2013they can match the same as their corresponding Perl Unicode classes:
2014C<[:upper:]> is the same as C<\p{IsUpper}>, etc. (There are some
2015exceptions and gotchas with this; see L<perlrecharclass> for a full
2016discussion.) The C<[:digit:]>, C<[:word:]>, and
2017C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
2018character classes. To negate a POSIX class, put a C<^> in front of
2019the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and, under
2020Unicode, C<\P{IsDigit}>. The Unicode and POSIX character classes can
2021be used just like C<\d>, with the exception that POSIX character
2022classes can only be used inside of a character class:
2023
2024 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
2025 /^=item\s[[:digit:]]/; # match '=item',
2026 # followed by a space and a digit
2027 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
2028 /^=item\s\p{IsDigit}/; # match '=item',
2029 # followed by a space and a digit
2030
2031Whew! That is all the rest of the characters and character classes.
2032
2033=head2 Compiling and saving regular expressions
2034
2035In Part 1 we mentioned that Perl compiles a regexp into a compact
2036sequence of opcodes. Thus, a compiled regexp is a data structure
2037that can be stored once and used again and again. The regexp quote
2038C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
2039regexp and transforms the result into a form that can be assigned to a
2040variable:
2041
2042 $reg = qr/foo+bar?/; # reg contains a compiled regexp
2043
2044Then C<$reg> can be used as a regexp:
2045
2046 $x = "fooooba";
2047 $x =~ $reg; # matches, just like /foo+bar?/
2048 $x =~ /$reg/; # same thing, alternate form
2049
2050C<$reg> can also be interpolated into a larger regexp:
2051
2052 $x =~ /(abc)?$reg/; # still matches
2053
2054As with the matching operator, the regexp quote can use different
2055delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes
2056as delimiters (C<qr''>) inhibit any interpolation.
2057
2058Pre-compiled regexps are useful for creating dynamic matches that
2059don't need to be recompiled each time they are encountered. Using
2060pre-compiled regexps, we write a C<grep_step> program which greps
2061for a sequence of patterns, advancing to the next pattern as soon
2062as one has been satisfied.
2063
2064 % cat > grep_step
2065 #!/usr/bin/perl
2066 # grep_step - match <number> regexps, one after the other
2067 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2068
2069 $number = shift;
2070 $regexp[$_] = shift foreach (0..$number-1);
2071 @compiled = map qr/$_/, @regexp;
2072 while ($line = <>) {
2073 if ($line =~ /$compiled[0]/) {
2074 print $line;
2075 shift @compiled;
2076 last unless @compiled;
2077 }
2078 }
2079 ^D
2080
2081 % grep_step 3 shift print last grep_step
2082 $number = shift;
2083 print $line;
2084 last unless @compiled;
2085
2086Storing pre-compiled regexps in an array C<@compiled> allows us to
2087simply loop through the regexps without any recompilation, thus gaining
2088flexibility without sacrificing speed.
2089
2090
2091=head2 Composing regular expressions at runtime
2092
2093Backtracking is more efficient than repeated tries with different regular
2094expressions. If there are several regular expressions and a match with
2095any of them is acceptable, then it is possible to combine them into a set
2096of alternatives. If the individual expressions are input data, this
2097can be done by programming a join operation. We'll exploit this idea in
2098an improved version of the C<simple_grep> program: a program that matches
2099multiple patterns:
2100
2101 % cat > multi_grep
2102 #!/usr/bin/perl
2103 # multi_grep - match any of <number> regexps
2104 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2105
2106 $number = shift;
2107 $regexp[$_] = shift foreach (0..$number-1);
2108 $pattern = join '|', @regexp;
2109
2110 while ($line = <>) {
2111 print $line if $line =~ /$pattern/;
2112 }
2113 ^D
2114
2115 % multi_grep 2 shift for multi_grep
2116 $number = shift;
2117 $regexp[$_] = shift foreach (0..$number-1);
2118
2119Sometimes it is advantageous to construct a pattern from the I<input>
2120that is to be analyzed and use the permissible values on the left
2121hand side of the matching operations. As an example for this somewhat
2122paradoxical situation, let's assume that our input contains a command
2123verb which should match one out of a set of available command verbs,
2124with the additional twist that commands may be abbreviated as long as
2125the given string is unique. The program below demonstrates the basic
2126algorithm.
2127
2128 % cat > keymatch
2129 #!/usr/bin/perl
2130 $kwds = 'copy compare list print';
2131 while( $cmd = <> ){
2132 $cmd =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
2133 if( ( @matches = $kwds =~ /\b$cmd\w*/g ) == 1 ){
2134 print "command: '@matches'\n";
2135 } elsif( @matches == 0 ){
2136 print "no such command: '$cmd'\n";
2137 } else {
2138 print "not unique: '$cmd' (could be one of: @matches)\n";
2139 }
2140 }
2141 ^D
2142
2143 % keymatch
2144 li
2145 command: 'list'
2146 co
2147 not unique: 'co' (could be one of: copy compare)
2148 printer
2149 no such command: 'printer'
2150
2151Rather than trying to match the input against the keywords, we match the
2152combined set of keywords against the input. The pattern matching
2153operation S<C<$kwds =~ /\b($cmd\w*)/g>> does several things at the
2154same time. It makes sure that the given command begins where a keyword
2155begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It
2156tells us the number of matches (C<scalar @matches>) and all the keywords
2157that were actually matched. You could hardly ask for more.
2158
2159=head2 Embedding comments and modifiers in a regular expression
2160
2161Starting with this section, we will be discussing Perl's set of
2162I<extended patterns>. These are extensions to the traditional regular
2163expression syntax that provide powerful new tools for pattern
2164matching. We have already seen extensions in the form of the minimal
2165matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. Most
2166of the extensions below have the form C<(?char...)>, where the
2167C<char> is a character that determines the type of extension.
2168
2169The first extension is an embedded comment C<(?#text)>. This embeds a
2170comment into the regular expression without affecting its meaning. The
2171comment should not have any closing parentheses in the text. An
2172example is
2173
2174 /(?# Match an integer:)[+-]?\d+/;
2175
2176This style of commenting has been largely superseded by the raw,
2177freeform commenting that is allowed with the C<//x> modifier.
2178
2179Most modifiers, such as C<//i>, C<//m>, C<//s> and C<//x> (or any
2180combination thereof) can also be embedded in
2181a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
2182
2183 /(?i)yes/; # match 'yes' case insensitively
2184 /yes/i; # same thing
2185 /(?x)( # freeform version of an integer regexp
2186 [+-]? # match an optional sign
2187 \d+ # match a sequence of digits
2188 )
2189 /x;
2190
2191Embedded modifiers can have two important advantages over the usual
2192modifiers. Embedded modifiers allow a custom set of modifiers to
2193I<each> regexp pattern. This is great for matching an array of regexps
2194that must have different modifiers:
2195
2196 $pattern[0] = '(?i)doctor';
2197 $pattern[1] = 'Johnson';
2198 ...
2199 while (<>) {
2200 foreach $patt (@pattern) {
2201 print if /$patt/;
2202 }
2203 }
2204
2205The second advantage is that embedded modifiers (except C<//p>, which
2206modifies the entire regexp) only affect the regexp
2207inside the group the embedded modifier is contained in. So grouping
2208can be used to localize the modifier's effects:
2209
2210 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
2211
2212Embedded modifiers can also turn off any modifiers already present
2213by using, e.g., C<(?-i)>. Modifiers can also be combined into
2214a single expression, e.g., C<(?s-i)> turns on single line mode and
2215turns off case insensitivity.
2216
2217Embedded modifiers may also be added to a non-capturing grouping.
2218C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
2219case insensitively and turns off multi-line mode.
2220
2221
2222=head2 Looking ahead and looking behind
2223
2224This section concerns the lookahead and lookbehind assertions. First,
2225a little background.
2226
2227In Perl regular expressions, most regexp elements 'eat up' a certain
2228amount of string when they match. For instance, the regexp element
2229C<[abc}]> eats up one character of the string when it matches, in the
2230sense that Perl moves to the next character position in the string
2231after the match. There are some elements, however, that don't eat up
2232characters (advance the character position) if they match. The examples
2233we have seen so far are the anchors. The anchor C<^> matches the
2234beginning of the line, but doesn't eat any characters. Similarly, the
2235word boundary anchor C<\b> matches wherever a character matching C<\w>
2236is next to a character that doesn't, but it doesn't eat up any
2237characters itself. Anchors are examples of I<zero-width assertions>:
2238zero-width, because they consume
2239no characters, and assertions, because they test some property of the
2240string. In the context of our walk in the woods analogy to regexp
2241matching, most regexp elements move us along a trail, but anchors have
2242us stop a moment and check our surroundings. If the local environment
2243checks out, we can proceed forward. But if the local environment
2244doesn't satisfy us, we must backtrack.
2245
2246Checking the environment entails either looking ahead on the trail,
2247looking behind, or both. C<^> looks behind, to see that there are no
2248characters before. C<$> looks ahead, to see that there are no
2249characters after. C<\b> looks both ahead and behind, to see if the
2250characters on either side differ in their "word-ness".
2251
2252The lookahead and lookbehind assertions are generalizations of the
2253anchor concept. Lookahead and lookbehind are zero-width assertions
2254that let us specify which characters we want to test for. The
2255lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
2256assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
2257
2258 $x = "I catch the housecat 'Tom-cat' with catnip";
2259 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
2260 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
2261 # $catwords[0] = 'catch'
2262 # $catwords[1] = 'catnip'
2263 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
2264 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
2265 # middle of $x
2266
2267Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
2268non-capturing, since these are zero-width assertions. Thus in the
2269second regexp, the substrings captured are those of the whole regexp
2270itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
2271lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
2272width, i.e., a fixed number of characters long. Thus
2273C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2274negated versions of the lookahead and lookbehind assertions are
2275denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2276They evaluate true if the regexps do I<not> match:
2277
2278 $x = "foobar";
2279 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2280 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2281 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2282
2283The C<\C> is unsupported in lookbehind, because the already
2284treacherous definition of C<\C> would become even more so
2285when going backwards.
2286
2287Here is an example where a string containing blank-separated words,
2288numbers and single dashes is to be split into its components.
2289Using C</\s+/> alone won't work, because spaces are not required between
2290dashes, or a word or a dash. Additional places for a split are established
2291by looking ahead and behind:
2292
2293 $str = "one two - --6-8";
2294 @toks = split / \s+ # a run of spaces
2295 | (?<=\S) (?=-) # any non-space followed by '-'
2296 | (?<=-) (?=\S) # a '-' followed by any non-space
2297 /x, $str; # @toks = qw(one two - - - 6 - 8)
2298
2299
2300=head2 Using independent subexpressions to prevent backtracking
2301
2302I<Independent subexpressions> are regular expressions, in the
2303context of a larger regular expression, that function independently of
2304the larger regular expression. That is, they consume as much or as
2305little of the string as they wish without regard for the ability of
2306the larger regexp to match. Independent subexpressions are represented
2307by C<< (?>regexp) >>. We can illustrate their behavior by first
2308considering an ordinary regexp:
2309
2310 $x = "ab";
2311 $x =~ /a*ab/; # matches
2312
2313This obviously matches, but in the process of matching, the
2314subexpression C<a*> first grabbed the C<a>. Doing so, however,
2315wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2316eventually gave back the C<a> and matched the empty string. Here, what
2317C<a*> matched was I<dependent> on what the rest of the regexp matched.
2318
2319Contrast that with an independent subexpression:
2320
2321 $x =~ /(?>a*)ab/; # doesn't match!
2322
2323The independent subexpression C<< (?>a*) >> doesn't care about the rest
2324of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2325regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
2326is no backtracking and the independent subexpression does not give
2327up its C<a>. Thus the match of the regexp as a whole fails. A similar
2328behavior occurs with completely independent regexps:
2329
2330 $x = "ab";
2331 $x =~ /a*/g; # matches, eats an 'a'
2332 $x =~ /\Gab/g; # doesn't match, no 'a' available
2333
2334Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2335one regexp to the other. Regexps with an independent subexpression are
2336much like this, with a handoff of the string to the independent
2337subexpression, and a handoff of the string back to the enclosing
2338regexp.
2339
2340The ability of an independent subexpression to prevent backtracking
2341can be quite useful. Suppose we want to match a non-empty string
2342enclosed in parentheses up to two levels deep. Then the following
2343regexp matches:
2344
2345 $x = "abc(de(fg)h"; # unbalanced parentheses
2346 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2347
2348The regexp matches an open parenthesis, one or more copies of an
2349alternation, and a close parenthesis. The alternation is two-way, with
2350the first alternative C<[^()]+> matching a substring with no
2351parentheses and the second alternative C<\([^()]*\)> matching a
2352substring delimited by parentheses. The problem with this regexp is
2353that it is pathological: it has nested indeterminate quantifiers
2354of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
2355like this could take an exponentially long time to execute if there
2356was no match possible. To prevent the exponential blowup, we need to
2357prevent useless backtracking at some point. This can be done by
2358enclosing the inner quantifier as an independent subexpression:
2359
2360 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2361
2362Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2363by gobbling up as much of the string as possible and keeping it. Then
2364match failures fail much more quickly.
2365
2366
2367=head2 Conditional expressions
2368
2369A I<conditional expression> is a form of if-then-else statement
2370that allows one to choose which patterns are to be matched, based on
2371some condition. There are two types of conditional expression:
2372C<(?(condition)yes-regexp)> and
2373C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
2374like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true,
2375the C<yes-regexp> will be matched. If the C<condition> is false, the
2376C<yes-regexp> will be skipped and Perl will move onto the next regexp
2377element. The second form is like an S<C<'if () {} else {}'>> statement
2378in Perl. If the C<condition> is true, the C<yes-regexp> will be
2379matched, otherwise the C<no-regexp> will be matched.
2380
2381The C<condition> can have several forms. The first form is simply an
2382integer in parentheses C<(integer)>. It is true if the corresponding
2383backreference C<\integer> matched earlier in the regexp. The same
2384thing can be done with a name associated with a capture group, written
2385as C<< (<name>) >> or C<< ('name') >>. The second form is a bare
2386zero-width assertion C<(?...)>, either a lookahead, a lookbehind, or a
2387code assertion (discussed in the next section). The third set of forms
2388provides tests that return true if the expression is executed within
2389a recursion (C<(R)>) or is being called from some capturing group,
2390referenced either by number (C<(R1)>, C<(R2)>,...) or by name
2391(C<(R&name)>).
2392
2393The integer or name form of the C<condition> allows us to choose,
2394with more flexibility, what to match based on what matched earlier in the
2395regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">:
2396
2397 % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
2398 beriberi
2399 coco
2400 couscous
2401 deed
2402 ...
2403 toot
2404 toto
2405 tutu
2406
2407The lookbehind C<condition> allows, along with backreferences,
2408an earlier part of the match to influence a later part of the
2409match. For instance,
2410
2411 /[ATGC]+(?(?<=AA)G|C)$/;
2412
2413matches a DNA sequence such that it either ends in C<AAG>, or some
2414other base pair combination and C<C>. Note that the form is
2415C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2416lookahead, lookbehind or code assertions, the parentheses around the
2417conditional are not needed.
2418
2419
2420=head2 Defining named patterns
2421
2422Some regular expressions use identical subpatterns in several places.
2423Starting with Perl 5.10, it is possible to define named subpatterns in
2424a section of the pattern so that they can be called up by name
2425anywhere in the pattern. This syntactic pattern for this definition
2426group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion
2427of a named pattern is written as C<(?&name)>.
2428
2429The example below illustrates this feature using the pattern for
2430floating point numbers that was presented earlier on. The three
2431subpatterns that are used more than once are the optional sign, the
2432digit sequence for an integer and the decimal fraction. The DEFINE
2433group at the end of the pattern contains their definition. Notice
2434that the decimal fraction pattern is the first place where we can
2435reuse the integer pattern.
2436
2437 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
2438 (?: [eE](?&osg)(?&int) )?
2439 $
2440 (?(DEFINE)
2441 (?<osg>[-+]?) # optional sign
2442 (?<int>\d++) # integer
2443 (?<dec>\.(?&int)) # decimal fraction
2444 )/x
2445
2446
2447=head2 Recursive patterns
2448
2449This feature (introduced in Perl 5.10) significantly extends the
2450power of Perl's pattern matching. By referring to some other
2451capture group anywhere in the pattern with the construct
2452C<(?group-ref)>, the I<pattern> within the referenced group is used
2453as an independent subpattern in place of the group reference itself.
2454Because the group reference may be contained I<within> the group it
2455refers to, it is now possible to apply pattern matching to tasks that
2456hitherto required a recursive parser.
2457
2458To illustrate this feature, we'll design a pattern that matches if
2459a string contains a palindrome. (This is a word or a sentence that,
2460while ignoring spaces, interpunctuation and case, reads the same backwards
2461as forwards. We begin by observing that the empty string or a string
2462containing just one word character is a palindrome. Otherwise it must
2463have a word character up front and the same at its end, with another
2464palindrome in between.
2465
2466 /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
2467
2468Adding C<\W*> at either end to eliminate what is to be ignored, we already
2469have the full pattern:
2470
2471 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
2472 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
2473 print "'$s' is a palindrome\n" if $s =~ /$pp/;
2474 }
2475
2476In C<(?...)> both absolute and relative backreferences may be used.
2477The entire pattern can be reinserted with C<(?R)> or C<(?0)>.
2478If you prefer to name your groups, you can use C<(?&name)> to
2479recurse into that group.
2480
2481
2482=head2 A bit of magic: executing Perl code in a regular expression
2483
2484Normally, regexps are a part of Perl expressions.
2485I<Code evaluation> expressions turn that around by allowing
2486arbitrary Perl code to be a part of a regexp. A code evaluation
2487expression is denoted C<(?{code})>, with I<code> a string of Perl
2488statements.
2489
2490Be warned that this feature is considered experimental, and may be
2491changed without notice.
2492
2493Code expressions are zero-width assertions, and the value they return
2494depends on their environment. There are two possibilities: either the
2495code expression is used as a conditional in a conditional expression
2496C<(?(condition)...)>, or it is not. If the code expression is a
2497conditional, the code is evaluated and the result (i.e., the result of
2498the last statement) is used to determine truth or falsehood. If the
2499code expression is not used as a conditional, the assertion always
2500evaluates true and the result is put into the special variable
2501C<$^R>. The variable C<$^R> can then be used in code expressions later
2502in the regexp. Here are some silly examples:
2503
2504 $x = "abcdef";
2505 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2506 # prints 'Hi Mom!'
2507 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2508 # no 'Hi Mom!'
2509
2510Pay careful attention to the next example:
2511
2512 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2513 # no 'Hi Mom!'
2514 # but why not?
2515
2516At first glance, you'd think that it shouldn't print, because obviously
2517the C<ddd> isn't going to match the target string. But look at this
2518example:
2519
2520 $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
2521 # but _does_ print
2522
2523Hmm. What happened here? If you've been following along, you know that
2524the above pattern should be effectively (almost) the same as the last one;
2525enclosing the C<d> in a character class isn't going to change what it
2526matches. So why does the first not print while the second one does?
2527
2528The answer lies in the optimizations the regex engine makes. In the first
2529case, all the engine sees are plain old characters (aside from the
2530C<?{}> construct). It's smart enough to realize that the string 'ddd'
2531doesn't occur in our target string before actually running the pattern
2532through. But in the second case, we've tricked it into thinking that our
2533pattern is more complicated. It takes a look, sees our
2534character class, and decides that it will have to actually run the
2535pattern to determine whether or not it matches, and in the process of
2536running it hits the print statement before it discovers that we don't
2537have a match.
2538
2539To take a closer look at how the engine does optimizations, see the
2540section L<"Pragmas and debugging"> below.
2541
2542More fun with C<?{}>:
2543
2544 $x =~ /(?{print "Hi Mom!";})/; # matches,
2545 # prints 'Hi Mom!'
2546 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2547 # prints '1'
2548 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2549 # prints '1'
2550
2551The bit of magic mentioned in the section title occurs when the regexp
2552backtracks in the process of searching for a match. If the regexp
2553backtracks over a code expression and if the variables used within are
2554localized using C<local>, the changes in the variables produced by the
2555code expression are undone! Thus, if we wanted to count how many times
2556a character got matched inside a group, we could use, e.g.,
2557
2558 $x = "aaaa";
2559 $count = 0; # initialize 'a' count
2560 $c = "bob"; # test if $c gets clobbered
2561 $x =~ /(?{local $c = 0;}) # initialize count
2562 ( a # match 'a'
2563 (?{local $c = $c + 1;}) # increment count
2564 )* # do this any number of times,
2565 aa # but match 'aa' at the end
2566 (?{$count = $c;}) # copy local $c var into $count
2567 /x;
2568 print "'a' count is $count, \$c variable is '$c'\n";
2569
2570This prints
2571
2572 'a' count is 2, $c variable is 'bob'
2573
2574If we replace the S<C< (?{local $c = $c + 1;})>> with
2575S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone
2576during backtracking, and we get
2577
2578 'a' count is 4, $c variable is 'bob'
2579
2580Note that only localized variable changes are undone. Other side
2581effects of code expression execution are permanent. Thus
2582
2583 $x = "aaaa";
2584 $x =~ /(a(?{print "Yow\n";}))*aa/;
2585
2586produces
2587
2588 Yow
2589 Yow
2590 Yow
2591 Yow
2592
2593The result C<$^R> is automatically localized, so that it will behave
2594properly in the presence of backtracking.
2595
2596This example uses a code expression in a conditional to match a
2597definite article, either 'the' in English or 'der|die|das' in German:
2598
2599 $lang = 'DE'; # use German
2600 ...
2601 $text = "das";
2602 print "matched\n"
2603 if $text =~ /(?(?{
2604 $lang eq 'EN'; # is the language English?
2605 })
2606 the | # if so, then match 'the'
2607 (der|die|das) # else, match 'der|die|das'
2608 )
2609 /xi;
2610
2611Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2612C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2613code expression, we don't need the extra parentheses around the
2614conditional.
2615
2616If you try to use code expressions where the code text is contained within
2617an interpolated variable, rather than appearing literally in the pattern,
2618Perl may surprise you:
2619
2620 $bar = 5;
2621 $pat = '(?{ 1 })';
2622 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2623 /foo(?{ 1 })$bar/; # compiles ok, $bar interpolated
2624 /foo${pat}bar/; # compile error!
2625
2626 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2627 /foo${pat}bar/; # compiles ok
2628
2629If a regexp has a variable that interpolates a code expression, Perl
2630treats the regexp as an error. If the code expression is precompiled into
2631a variable, however, interpolating is ok. The question is, why is this an
2632error?
2633
2634The reason is that variable interpolation and code expressions
2635together pose a security risk. The combination is dangerous because
2636many programmers who write search engines often take user input and
2637plug it directly into a regexp:
2638
2639 $regexp = <>; # read user-supplied regexp
2640 $chomp $regexp; # get rid of possible newline
2641 $text =~ /$regexp/; # search $text for the $regexp
2642
2643If the C<$regexp> variable contains a code expression, the user could
2644then execute arbitrary Perl code. For instance, some joker could
2645search for S<C<system('rm -rf *');>> to erase your files. In this
2646sense, the combination of interpolation and code expressions I<taints>
2647your regexp. So by default, using both interpolation and code
2648expressions in the same regexp is not allowed. If you're not
2649concerned about malicious users, it is possible to bypass this
2650security check by invoking S<C<use re 'eval'>>:
2651
2652 use re 'eval'; # throw caution out the door
2653 $bar = 5;
2654 $pat = '(?{ 1 })';
2655 /foo${pat}bar/; # compiles ok
2656
2657Another form of code expression is the I<pattern code expression>.
2658The pattern code expression is like a regular code expression, except
2659that the result of the code evaluation is treated as a regular
2660expression and matched immediately. A simple example is
2661
2662 $length = 5;
2663 $char = 'a';
2664 $x = 'aaaaabb';
2665 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2666
2667
2668This final example contains both ordinary and pattern code
2669expressions. It detects whether a binary string C<1101010010001...> has a
2670Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2671
2672 $x = "1101010010001000001";
2673 $z0 = ''; $z1 = '0'; # initial conditions
2674 print "It is a Fibonacci sequence\n"
2675 if $x =~ /^1 # match an initial '1'
2676 (?:
2677 ((??{ $z0 })) # match some '0'
2678 1 # and then a '1'
2679 (?{ $z0 = $z1; $z1 .= $^N; })
2680 )+ # repeat as needed
2681 $ # that is all there is
2682 /x;
2683 printf "Largest sequence matched was %d\n", length($z1)-length($z0);
2684
2685Remember that C<$^N> is set to whatever was matched by the last
2686completed capture group. This prints
2687
2688 It is a Fibonacci sequence
2689 Largest sequence matched was 5
2690
2691Ha! Try that with your garden variety regexp package...
2692
2693Note that the variables C<$z0> and C<$z1> are not substituted when the
2694regexp is compiled, as happens for ordinary variables outside a code
2695expression. Rather, the whole code block is parsed as perl code at the
2696same time as perl is compiling the code containing the literal regexp
2697pattern.
2698
2699The regexp without the C<//x> modifier is
2700
2701 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
2702
2703which shows that spaces are still possible in the code parts. Nevertheless,
2704when working with code and conditional expressions, the extended form of
2705regexps is almost necessary in creating and debugging regexps.
2706
2707
2708=head2 Backtracking control verbs
2709
2710Perl 5.10 introduced a number of control verbs intended to provide
2711detailed control over the backtracking process, by directly influencing
2712the regexp engine and by providing monitoring techniques. As all
2713the features in this group are experimental and subject to change or
2714removal in a future version of Perl, the interested reader is
2715referred to L<perlre/"Special Backtracking Control Verbs"> for a
2716detailed description.
2717
2718Below is just one example, illustrating the control verb C<(*FAIL)>,
2719which may be abbreviated as C<(*F)>. If this is inserted in a regexp
2720it will cause it to fail, just as it would at some
2721mismatch between the pattern and the string. Processing
2722of the regexp continues as it would after any "normal"
2723failure, so that, for instance, the next position in the string or another
2724alternative will be tried. As failing to match doesn't preserve capture
2725groups or produce results, it may be necessary to use this in
2726combination with embedded code.
2727
2728 %count = ();
2729 "supercalifragilisticexpialidocious" =~
2730 /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
2731 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
2732
2733The pattern begins with a class matching a subset of letters. Whenever
2734this matches, a statement like C<$count{'a'}++;> is executed, incrementing
2735the letter's counter. Then C<(*FAIL)> does what it says, and
2736the regexp engine proceeds according to the book: as long as the end of
2737the string hasn't been reached, the position is advanced before looking
2738for another vowel. Thus, match or no match makes no difference, and the
2739regexp engine proceeds until the entire string has been inspected.
2740(It's remarkable that an alternative solution using something like
2741
2742 $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
2743 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
2744
2745is considerably slower.)
2746
2747
2748=head2 Pragmas and debugging
2749
2750Speaking of debugging, there are several pragmas available to control
2751and debug regexps in Perl. We have already encountered one pragma in
2752the previous section, S<C<use re 'eval';>>, that allows variable
2753interpolation and code expressions to coexist in a regexp. The other
2754pragmas are
2755
2756 use re 'taint';
2757 $tainted = <>;
2758 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2759
2760The C<taint> pragma causes any substrings from a match with a tainted
2761variable to be tainted as well. This is not normally the case, as
2762regexps are often used to extract the safe bits from a tainted
2763variable. Use C<taint> when you are not extracting safe bits, but are
2764performing some other processing. Both C<taint> and C<eval> pragmas
2765are lexically scoped, which means they are in effect only until
2766the end of the block enclosing the pragmas.
2767
2768 use re '/m'; # or any other flags
2769 $multiline_string =~ /^foo/; # /m is implied
2770
2771The C<re '/flags'> pragma (introduced in Perl
27725.14) turns on the given regular expression flags
2773until the end of the lexical scope. See
2774L<re/"'E<sol>flags' mode"> for more
2775detail.
2776
2777 use re 'debug';
2778 /^(.*)$/s; # output debugging info
2779
2780 use re 'debugcolor';
2781 /^(.*)$/s; # output debugging info in living color
2782
2783The global C<debug> and C<debugcolor> pragmas allow one to get
2784detailed debugging info about regexp compilation and
2785execution. C<debugcolor> is the same as debug, except the debugging
2786information is displayed in color on terminals that can display
2787termcap color sequences. Here is example output:
2788
2789 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2790 Compiling REx 'a*b+c'
2791 size 9 first at 1
2792 1: STAR(4)
2793 2: EXACT <a>(0)
2794 4: PLUS(7)
2795 5: EXACT <b>(0)
2796 7: EXACT <c>(9)
2797 9: END(0)
2798 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2799 Guessing start of match, REx 'a*b+c' against 'abc'...
2800 Found floating substr 'bc' at offset 1...
2801 Guessed: match at offset 0
2802 Matching REx 'a*b+c' against 'abc'
2803 Setting an EVAL scope, savestack=3
2804 0 <> <abc> | 1: STAR
2805 EXACT <a> can match 1 times out of 32767...
2806 Setting an EVAL scope, savestack=3
2807 1 <a> <bc> | 4: PLUS
2808 EXACT <b> can match 1 times out of 32767...
2809 Setting an EVAL scope, savestack=3
2810 2 <ab> <c> | 7: EXACT <c>
2811 3 <abc> <> | 9: END
2812 Match successful!
2813 Freeing REx: 'a*b+c'
2814
2815If you have gotten this far into the tutorial, you can probably guess
2816what the different parts of the debugging output tell you. The first
2817part
2818
2819 Compiling REx 'a*b+c'
2820 size 9 first at 1
2821 1: STAR(4)
2822 2: EXACT <a>(0)
2823 4: PLUS(7)
2824 5: EXACT <b>(0)
2825 7: EXACT <c>(9)
2826 9: END(0)
2827
2828describes the compilation stage. C<STAR(4)> means that there is a
2829starred object, in this case C<'a'>, and if it matches, goto line 4,
2830i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2831optimizations performed before a match:
2832
2833 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2834 Guessing start of match, REx 'a*b+c' against 'abc'...
2835 Found floating substr 'bc' at offset 1...
2836 Guessed: match at offset 0
2837
2838Then the match is executed and the remaining lines describe the
2839process:
2840
2841 Matching REx 'a*b+c' against 'abc'
2842 Setting an EVAL scope, savestack=3
2843 0 <> <abc> | 1: STAR
2844 EXACT <a> can match 1 times out of 32767...
2845 Setting an EVAL scope, savestack=3
2846 1 <a> <bc> | 4: PLUS
2847 EXACT <b> can match 1 times out of 32767...
2848 Setting an EVAL scope, savestack=3
2849 2 <ab> <c> | 7: EXACT <c>
2850 3 <abc> <> | 9: END
2851 Match successful!
2852 Freeing REx: 'a*b+c'
2853
2854Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the
2855part of the string matched and C<< <y> >> the part not yet
2856matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1
2857in the compilation list above. See
2858L<perldebguts/"Debugging Regular Expressions"> for much more detail.
2859
2860An alternative method of debugging regexps is to embed C<print>
2861statements within the regexp. This provides a blow-by-blow account of
2862the backtracking in an alternation:
2863
2864 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2865 t(?{print "t1\n";})
2866 h(?{print "h1\n";})
2867 i(?{print "i1\n";})
2868 s(?{print "s1\n";})
2869 |
2870 t(?{print "t2\n";})
2871 h(?{print "h2\n";})
2872 a(?{print "a2\n";})
2873 t(?{print "t2\n";})
2874 (?{print "Done at position ", pos, "\n";})
2875 @x;
2876
2877prints
2878
2879 Start at position 0
2880 t1
2881 h1
2882 t2
2883 h2
2884 a2
2885 t2
2886 Done at position 4
2887
2888=head1 BUGS
2889
2890Code expressions, conditional expressions, and independent expressions
2891are I<experimental>. Don't use them in production code. Yet.
2892
2893=head1 SEE ALSO
2894
2895This is just a tutorial. For the full story on Perl regular
2896expressions, see the L<perlre> regular expressions reference page.
2897
2898For more information on the matching C<m//> and substitution C<s///>
2899operators, see L<perlop/"Regexp Quote-Like Operators">. For
2900information on the C<split> operation, see L<perlfunc/split>.
2901
2902For an excellent all-around resource on the care and feeding of
2903regular expressions, see the book I<Mastering Regular Expressions> by
2904Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2905
2906=head1 AUTHOR AND COPYRIGHT
2907
2908Copyright (c) 2000 Mark Kvale
2909All rights reserved.
2910
2911This document may be distributed under the same terms as Perl itself.
2912
2913=head2 Acknowledgments
2914
2915The inspiration for the stop codon DNA example came from the ZIP
2916code example in chapter 7 of I<Mastering Regular Expressions>.
2917
2918The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2919Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2920comments.
2921
2922=cut
2923