Commit | Line | Data |
---|---|---|
47f9c88b GS |
1 | =head1 NAME |
2 | ||
3 | perlretut - Perl regular expressions tutorial | |
4 | ||
5 | =head1 DESCRIPTION | |
6 | ||
7 | This page provides a basic tutorial on understanding, creating and | |
8 | using regular expressions in Perl. It serves as a complement to the | |
9 | reference page on regular expressions L<perlre>. Regular expressions | |
10 | are an integral part of the C<m//>, C<s///>, C<qr//> and C<split> | |
11 | operators and so this tutorial also overlaps with | |
12 | L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>. | |
13 | ||
14 | Perl is widely renowned for excellence in text processing, and regular | |
15 | expressions are one of the big factors behind this fame. Perl regular | |
16 | expressions display an efficiency and flexibility unknown in most | |
17 | other computer languages. Mastering even the basics of regular | |
18 | expressions will allow you to manipulate text with surprising ease. | |
19 | ||
20 | What is a regular expression? A regular expression is simply a string | |
21 | that describes a pattern. Patterns are in common use these days; | |
22 | examples are the patterns typed into a search engine to find web pages | |
23 | and the patterns used to list files in a directory, e.g., C<ls *.txt> | |
24 | or C<dir *.*>. In Perl, the patterns described by regular expressions | |
25 | are used to search strings, extract desired parts of strings, and to | |
26 | do search and replace operations. | |
27 | ||
28 | Regular expressions have the undeserved reputation of being abstract | |
29 | and difficult to understand. Regular expressions are constructed using | |
30 | simple concepts like conditionals and loops and are no more difficult | |
31 | to understand than the corresponding C<if> conditionals and C<while> | |
32 | loops in the Perl language itself. In fact, the main challenge in | |
33 | learning regular expressions is just getting used to the terse | |
34 | notation used to express these concepts. | |
35 | ||
36 | This tutorial flattens the learning curve by discussing regular | |
37 | expression concepts, along with their notation, one at a time and with | |
38 | many examples. The first part of the tutorial will progress from the | |
39 | simplest word searches to the basic regular expression concepts. If | |
40 | you master the first part, you will have all the tools needed to solve | |
41 | about 98% of your needs. The second part of the tutorial is for those | |
42 | comfortable with the basics and hungry for more power tools. It | |
43 | discusses the more advanced regular expression operators and | |
44 | introduces the latest cutting edge innovations in 5.6.0. | |
45 | ||
46 | A note: to save time, 'regular expression' is often abbreviated as | |
47 | regexp or regex. Regexp is a more natural abbreviation than regex, but | |
48 | is harder to pronounce. The Perl pod documentation is evenly split on | |
49 | regexp vs regex; in Perl, there is more than one way to abbreviate it. | |
50 | We'll use regexp in this tutorial. | |
51 | ||
52 | =head1 Part 1: The basics | |
53 | ||
54 | =head2 Simple word matching | |
55 | ||
56 | The simplest regexp is simply a word, or more generally, a string of | |
57 | characters. A regexp consisting of a word matches any string that | |
58 | contains that word: | |
59 | ||
60 | "Hello World" =~ /World/; # matches | |
61 | ||
62 | What is this perl statement all about? C<"Hello World"> is a simple | |
63 | double quoted string. C<World> is the regular expression and the | |
64 | C<//> enclosing C</World/> tells perl to search a string for a match. | |
65 | The operator C<=~> associates the string with the regexp match and | |
66 | produces a true value if the regexp matched, or false if the regexp | |
67 | did not match. In our case, C<World> matches the second word in | |
68 | C<"Hello World">, so the expression is true. Expressions like this | |
69 | are useful in conditionals: | |
70 | ||
71 | if ("Hello World" =~ /World/) { | |
72 | print "It matches\n"; | |
73 | } | |
74 | else { | |
75 | print "It doesn't match\n"; | |
76 | } | |
77 | ||
78 | There are useful variations on this theme. The sense of the match can | |
79 | be reversed by using C<!~> operator: | |
80 | ||
81 | if ("Hello World" !~ /World/) { | |
82 | print "It doesn't match\n"; | |
83 | } | |
84 | else { | |
85 | print "It matches\n"; | |
86 | } | |
87 | ||
88 | The literal string in the regexp can be replaced by a variable: | |
89 | ||
90 | $greeting = "World"; | |
91 | if ("Hello World" =~ /$greeting/) { | |
92 | print "It matches\n"; | |
93 | } | |
94 | else { | |
95 | print "It doesn't match\n"; | |
96 | } | |
97 | ||
98 | If you're matching against the special default variable C<$_>, the | |
99 | C<$_ =~> part can be omitted: | |
100 | ||
101 | $_ = "Hello World"; | |
102 | if (/World/) { | |
103 | print "It matches\n"; | |
104 | } | |
105 | else { | |
106 | print "It doesn't match\n"; | |
107 | } | |
108 | ||
109 | And finally, the C<//> default delimiters for a match can be changed | |
110 | to arbitrary delimiters by putting an C<'m'> out front: | |
111 | ||
112 | "Hello World" =~ m!World!; # matches, delimited by '!' | |
113 | "Hello World" =~ m{World}; # matches, note the matching '{}' | |
a6b2f353 GS |
114 | "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin', |
115 | # '/' becomes an ordinary char | |
47f9c88b GS |
116 | |
117 | C</World/>, C<m!World!>, and C<m{World}> all represent the | |
118 | same thing. When, e.g., C<""> is used as a delimiter, the forward | |
119 | slash C<'/'> becomes an ordinary character and can be used in a regexp | |
120 | without trouble. | |
121 | ||
122 | Let's consider how different regexps would match C<"Hello World">: | |
123 | ||
124 | "Hello World" =~ /world/; # doesn't match | |
125 | "Hello World" =~ /o W/; # matches | |
126 | "Hello World" =~ /oW/; # doesn't match | |
127 | "Hello World" =~ /World /; # doesn't match | |
128 | ||
129 | The first regexp C<world> doesn't match because regexps are | |
130 | case-sensitive. The second regexp matches because the substring | |
131 | S<C<'o W'> > occurs in the string S<C<"Hello World"> >. The space | |
132 | character ' ' is treated like any other character in a regexp and is | |
133 | needed to match in this case. The lack of a space character is the | |
134 | reason the third regexp C<'oW'> doesn't match. The fourth regexp | |
135 | C<'World '> doesn't match because there is a space at the end of the | |
136 | regexp, but not at the end of the string. The lesson here is that | |
137 | regexps must match a part of the string I<exactly> in order for the | |
138 | statement to be true. | |
139 | ||
140 | If a regexp matches in more than one place in the string, perl will | |
141 | always match at the earliest possible point in the string: | |
142 | ||
143 | "Hello World" =~ /o/; # matches 'o' in 'Hello' | |
144 | "That hat is red" =~ /hat/; # matches 'hat' in 'That' | |
145 | ||
146 | With respect to character matching, there are a few more points you | |
147 | need to know about. First of all, not all characters can be used 'as | |
148 | is' in a match. Some characters, called B<metacharacters>, are reserved | |
149 | for use in regexp notation. The metacharacters are | |
150 | ||
151 | {}[]()^$.|*+?\ | |
152 | ||
153 | The significance of each of these will be explained | |
154 | in the rest of the tutorial, but for now, it is important only to know | |
155 | that a metacharacter can be matched by putting a backslash before it: | |
156 | ||
157 | "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter | |
158 | "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary + | |
159 | "The interval is [0,1)." =~ /[0,1)./ # is a syntax error! | |
160 | "The interval is [0,1)." =~ /\[0,1\)\./ # matches | |
865c4c6f | 161 | "/usr/bin/perl" =~ /\/usr\/bin\/perl/; # matches |
47f9c88b GS |
162 | |
163 | In the last regexp, the forward slash C<'/'> is also backslashed, | |
164 | because it is used to delimit the regexp. This can lead to LTS | |
165 | (leaning toothpick syndrome), however, and it is often more readable | |
166 | to change delimiters. | |
167 | ||
865c4c6f | 168 | "/usr/bin/perl" =~ m!/usr/bin/perl!; # easier to read |
47f9c88b GS |
169 | |
170 | The backslash character C<'\'> is a metacharacter itself and needs to | |
171 | be backslashed: | |
172 | ||
173 | 'C:\WIN32' =~ /C:\\WIN/; # matches | |
174 | ||
175 | In addition to the metacharacters, there are some ASCII characters | |
176 | which don't have printable character equivalents and are instead | |
177 | represented by B<escape sequences>. Common examples are C<\t> for a | |
178 | tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a | |
179 | bell. If your string is better thought of as a sequence of arbitrary | |
180 | bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape | |
181 | sequence, e.g., C<\x1B> may be a more natural representation for your | |
182 | bytes. Here are some examples of escapes: | |
183 | ||
184 | "1000\t2000" =~ m(0\t2) # matches | |
185 | "1000\n2000" =~ /0\n20/ # matches | |
186 | "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000" | |
187 | "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat | |
188 | ||
189 | If you've been around Perl a while, all this talk of escape sequences | |
190 | may seem familiar. Similar escape sequences are used in double-quoted | |
191 | strings and in fact the regexps in Perl are mostly treated as | |
192 | double-quoted strings. This means that variables can be used in | |
193 | regexps as well. Just like double-quoted strings, the values of the | |
194 | variables in the regexp will be substituted in before the regexp is | |
195 | evaluated for matching purposes. So we have: | |
196 | ||
197 | $foo = 'house'; | |
198 | 'housecat' =~ /$foo/; # matches | |
199 | 'cathouse' =~ /cat$foo/; # matches | |
47f9c88b GS |
200 | 'housecat' =~ /${foo}cat/; # matches |
201 | ||
202 | So far, so good. With the knowledge above you can already perform | |
203 | searches with just about any literal string regexp you can dream up. | |
204 | Here is a I<very simple> emulation of the Unix grep program: | |
205 | ||
206 | % cat > simple_grep | |
207 | #!/usr/bin/perl | |
208 | $regexp = shift; | |
209 | while (<>) { | |
210 | print if /$regexp/; | |
211 | } | |
212 | ^D | |
213 | ||
214 | % chmod +x simple_grep | |
215 | ||
216 | % simple_grep abba /usr/dict/words | |
217 | Babbage | |
218 | cabbage | |
219 | cabbages | |
220 | sabbath | |
221 | Sabbathize | |
222 | Sabbathizes | |
223 | sabbatical | |
224 | scabbard | |
225 | scabbards | |
226 | ||
227 | This program is easy to understand. C<#!/usr/bin/perl> is the standard | |
228 | way to invoke a perl program from the shell. | |
229 | S<C<$regexp = shift;> > saves the first command line argument as the | |
230 | regexp to be used, leaving the rest of the command line arguments to | |
231 | be treated as files. S<C<< while (<>) >> > loops over all the lines in | |
232 | all the files. For each line, S<C<print if /$regexp/;> > prints the | |
233 | line if the regexp matches the line. In this line, both C<print> and | |
234 | C</$regexp/> use the default variable C<$_> implicitly. | |
235 | ||
236 | With all of the regexps above, if the regexp matched anywhere in the | |
237 | string, it was considered a match. Sometimes, however, we'd like to | |
238 | specify I<where> in the string the regexp should try to match. To do | |
239 | this, we would use the B<anchor> metacharacters C<^> and C<$>. The | |
240 | anchor C<^> means match at the beginning of the string and the anchor | |
241 | C<$> means match at the end of the string, or before a newline at the | |
242 | end of the string. Here is how they are used: | |
243 | ||
244 | "housekeeper" =~ /keeper/; # matches | |
245 | "housekeeper" =~ /^keeper/; # doesn't match | |
246 | "housekeeper" =~ /keeper$/; # matches | |
247 | "housekeeper\n" =~ /keeper$/; # matches | |
248 | ||
249 | The second regexp doesn't match because C<^> constrains C<keeper> to | |
250 | match only at the beginning of the string, but C<"housekeeper"> has | |
251 | keeper starting in the middle. The third regexp does match, since the | |
252 | C<$> constrains C<keeper> to match only at the end of the string. | |
253 | ||
254 | When both C<^> and C<$> are used at the same time, the regexp has to | |
255 | match both the beginning and the end of the string, i.e., the regexp | |
256 | matches the whole string. Consider | |
257 | ||
258 | "keeper" =~ /^keep$/; # doesn't match | |
259 | "keeper" =~ /^keeper$/; # matches | |
260 | "" =~ /^$/; # ^$ matches an empty string | |
261 | ||
262 | The first regexp doesn't match because the string has more to it than | |
263 | C<keep>. Since the second regexp is exactly the string, it | |
264 | matches. Using both C<^> and C<$> in a regexp forces the complete | |
265 | string to match, so it gives you complete control over which strings | |
266 | match and which don't. Suppose you are looking for a fellow named | |
267 | bert, off in a string by himself: | |
268 | ||
269 | "dogbert" =~ /bert/; # matches, but not what you want | |
270 | ||
271 | "dilbert" =~ /^bert/; # doesn't match, but .. | |
272 | "bertram" =~ /^bert/; # matches, so still not good enough | |
273 | ||
274 | "bertram" =~ /^bert$/; # doesn't match, good | |
275 | "dilbert" =~ /^bert$/; # doesn't match, good | |
276 | "bert" =~ /^bert$/; # matches, perfect | |
277 | ||
278 | Of course, in the case of a literal string, one could just as easily | |
279 | use the string equivalence S<C<$string eq 'bert'> > and it would be | |
280 | more efficient. The C<^...$> regexp really becomes useful when we | |
281 | add in the more powerful regexp tools below. | |
282 | ||
283 | =head2 Using character classes | |
284 | ||
285 | Although one can already do quite a lot with the literal string | |
286 | regexps above, we've only scratched the surface of regular expression | |
287 | technology. In this and subsequent sections we will introduce regexp | |
288 | concepts (and associated metacharacter notations) that will allow a | |
289 | regexp to not just represent a single character sequence, but a I<whole | |
290 | class> of them. | |
291 | ||
292 | One such concept is that of a B<character class>. A character class | |
293 | allows a set of possible characters, rather than just a single | |
294 | character, to match at a particular point in a regexp. Character | |
295 | classes are denoted by brackets C<[...]>, with the set of characters | |
296 | to be possibly matched inside. Here are some examples: | |
297 | ||
298 | /cat/; # matches 'cat' | |
299 | /[bcr]at/; # matches 'bat, 'cat', or 'rat' | |
300 | /item[0123456789]/; # matches 'item0' or ... or 'item9' | |
a6b2f353 | 301 | "abc" =~ /[cab]/; # matches 'a' |
47f9c88b GS |
302 | |
303 | In the last statement, even though C<'c'> is the first character in | |
304 | the class, C<'a'> matches because the first character position in the | |
305 | string is the earliest point at which the regexp can match. | |
306 | ||
307 | /[yY][eE][sS]/; # match 'yes' in a case-insensitive way | |
308 | # 'yes', 'Yes', 'YES', etc. | |
309 | ||
da75cd15 | 310 | This regexp displays a common task: perform a case-insensitive |
47f9c88b GS |
311 | match. Perl provides away of avoiding all those brackets by simply |
312 | appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;> | |
313 | can be rewritten as C</yes/i;>. The C<'i'> stands for | |
314 | case-insensitive and is an example of a B<modifier> of the matching | |
315 | operation. We will meet other modifiers later in the tutorial. | |
316 | ||
317 | We saw in the section above that there were ordinary characters, which | |
318 | represented themselves, and special characters, which needed a | |
319 | backslash C<\> to represent themselves. The same is true in a | |
320 | character class, but the sets of ordinary and special characters | |
321 | inside a character class are different than those outside a character | |
322 | class. The special characters for a character class are C<-]\^$>. C<]> | |
323 | is special because it denotes the end of a character class. C<$> is | |
324 | special because it denotes a scalar variable. C<\> is special because | |
325 | it is used in escape sequences, just like above. Here is how the | |
326 | special characters C<]$\> are handled: | |
327 | ||
328 | /[\]c]def/; # matches ']def' or 'cdef' | |
329 | $x = 'bcr'; | |
a6b2f353 | 330 | /[$x]at/; # matches 'bat', 'cat', or 'rat' |
47f9c88b GS |
331 | /[\$x]at/; # matches '$at' or 'xat' |
332 | /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat' | |
333 | ||
334 | The last two are a little tricky. in C<[\$x]>, the backslash protects | |
335 | the dollar sign, so the character class has two members C<$> and C<x>. | |
336 | In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a | |
337 | variable and substituted in double quote fashion. | |
338 | ||
339 | The special character C<'-'> acts as a range operator within character | |
340 | classes, so that a contiguous set of characters can be written as a | |
341 | range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]> | |
342 | become the svelte C<[0-9]> and C<[a-z]>. Some examples are | |
343 | ||
344 | /item[0-9]/; # matches 'item0' or ... or 'item9' | |
345 | /[0-9bx-z]aa/; # matches '0aa', ..., '9aa', | |
346 | # 'baa', 'xaa', 'yaa', or 'zaa' | |
347 | /[0-9a-fA-F]/; # matches a hexadecimal digit | |
36bbe248 | 348 | /[0-9a-zA-Z_]/; # matches a "word" character, |
47f9c88b GS |
349 | # like those in a perl variable name |
350 | ||
351 | If C<'-'> is the first or last character in a character class, it is | |
352 | treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are | |
353 | all equivalent. | |
354 | ||
355 | The special character C<^> in the first position of a character class | |
356 | denotes a B<negated character class>, which matches any character but | |
a6b2f353 | 357 | those in the brackets. Both C<[...]> and C<[^...]> must match a |
47f9c88b GS |
358 | character, or the match fails. Then |
359 | ||
360 | /[^a]at/; # doesn't match 'aat' or 'at', but matches | |
361 | # all other 'bat', 'cat, '0at', '%at', etc. | |
362 | /[^0-9]/; # matches a non-numeric character | |
363 | /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary | |
364 | ||
365 | Now, even C<[0-9]> can be a bother the write multiple times, so in the | |
366 | interest of saving keystrokes and making regexps more readable, Perl | |
367 | has several abbreviations for common character classes: | |
368 | ||
369 | =over 4 | |
370 | ||
371 | =item * | |
551e1d92 | 372 | |
47f9c88b GS |
373 | \d is a digit and represents [0-9] |
374 | ||
375 | =item * | |
551e1d92 | 376 | |
47f9c88b GS |
377 | \s is a whitespace character and represents [\ \t\r\n\f] |
378 | ||
379 | =item * | |
551e1d92 | 380 | |
47f9c88b GS |
381 | \w is a word character (alphanumeric or _) and represents [0-9a-zA-Z_] |
382 | ||
383 | =item * | |
551e1d92 | 384 | |
47f9c88b GS |
385 | \D is a negated \d; it represents any character but a digit [^0-9] |
386 | ||
387 | =item * | |
551e1d92 | 388 | |
47f9c88b GS |
389 | \S is a negated \s; it represents any non-whitespace character [^\s] |
390 | ||
391 | =item * | |
551e1d92 | 392 | |
47f9c88b GS |
393 | \W is a negated \w; it represents any non-word character [^\w] |
394 | ||
395 | =item * | |
551e1d92 | 396 | |
47f9c88b GS |
397 | The period '.' matches any character but "\n" |
398 | ||
399 | =back | |
400 | ||
401 | The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside | |
402 | of character classes. Here are some in use: | |
403 | ||
404 | /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format | |
405 | /[\d\s]/; # matches any digit or whitespace character | |
406 | /\w\W\w/; # matches a word char, followed by a | |
407 | # non-word char, followed by a word char | |
408 | /..rt/; # matches any two chars, followed by 'rt' | |
409 | /end\./; # matches 'end.' | |
410 | /end[.]/; # same thing, matches 'end.' | |
411 | ||
412 | Because a period is a metacharacter, it needs to be escaped to match | |
413 | as an ordinary period. Because, for example, C<\d> and C<\w> are sets | |
414 | of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in | |
415 | fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as | |
416 | C<[\W]>. Think DeMorgan's laws. | |
417 | ||
418 | An anchor useful in basic regexps is the S<B<word anchor> > | |
419 | C<\b>. This matches a boundary between a word character and a non-word | |
420 | character C<\w\W> or C<\W\w>: | |
421 | ||
422 | $x = "Housecat catenates house and cat"; | |
423 | $x =~ /cat/; # matches cat in 'housecat' | |
424 | $x =~ /\bcat/; # matches cat in 'catenates' | |
425 | $x =~ /cat\b/; # matches cat in 'housecat' | |
426 | $x =~ /\bcat\b/; # matches 'cat' at end of string | |
427 | ||
428 | Note in the last example, the end of the string is considered a word | |
429 | boundary. | |
430 | ||
431 | You might wonder why C<'.'> matches everything but C<"\n"> - why not | |
432 | every character? The reason is that often one is matching against | |
433 | lines and would like to ignore the newline characters. For instance, | |
434 | while the string C<"\n"> represents one line, we would like to think | |
435 | of as empty. Then | |
436 | ||
437 | "" =~ /^$/; # matches | |
438 | "\n" =~ /^$/; # matches, "\n" is ignored | |
439 | ||
440 | "" =~ /./; # doesn't match; it needs a char | |
441 | "" =~ /^.$/; # doesn't match; it needs a char | |
442 | "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n" | |
443 | "a" =~ /^.$/; # matches | |
444 | "a\n" =~ /^.$/; # matches, ignores the "\n" | |
445 | ||
446 | This behavior is convenient, because we usually want to ignore | |
447 | newlines when we count and match characters in a line. Sometimes, | |
448 | however, we want to keep track of newlines. We might even want C<^> | |
449 | and C<$> to anchor at the beginning and end of lines within the | |
450 | string, rather than just the beginning and end of the string. Perl | |
451 | allows us to choose between ignoring and paying attention to newlines | |
452 | by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for | |
453 | single line and multi-line and they determine whether a string is to | |
454 | be treated as one continuous string, or as a set of lines. The two | |
455 | modifiers affect two aspects of how the regexp is interpreted: 1) how | |
456 | the C<'.'> character class is defined, and 2) where the anchors C<^> | |
457 | and C<$> are able to match. Here are the four possible combinations: | |
458 | ||
459 | =over 4 | |
460 | ||
461 | =item * | |
551e1d92 | 462 | |
47f9c88b GS |
463 | no modifiers (//): Default behavior. C<'.'> matches any character |
464 | except C<"\n">. C<^> matches only at the beginning of the string and | |
465 | C<$> matches only at the end or before a newline at the end. | |
466 | ||
467 | =item * | |
551e1d92 | 468 | |
47f9c88b GS |
469 | s modifier (//s): Treat string as a single long line. C<'.'> matches |
470 | any character, even C<"\n">. C<^> matches only at the beginning of | |
471 | the string and C<$> matches only at the end or before a newline at the | |
472 | end. | |
473 | ||
474 | =item * | |
551e1d92 | 475 | |
47f9c88b GS |
476 | m modifier (//m): Treat string as a set of multiple lines. C<'.'> |
477 | matches any character except C<"\n">. C<^> and C<$> are able to match | |
478 | at the start or end of I<any> line within the string. | |
479 | ||
480 | =item * | |
551e1d92 | 481 | |
47f9c88b GS |
482 | both s and m modifiers (//sm): Treat string as a single long line, but |
483 | detect multiple lines. C<'.'> matches any character, even | |
484 | C<"\n">. C<^> and C<$>, however, are able to match at the start or end | |
485 | of I<any> line within the string. | |
486 | ||
487 | =back | |
488 | ||
489 | Here are examples of C<//s> and C<//m> in action: | |
490 | ||
491 | $x = "There once was a girl\nWho programmed in Perl\n"; | |
492 | ||
493 | $x =~ /^Who/; # doesn't match, "Who" not at start of string | |
494 | $x =~ /^Who/s; # doesn't match, "Who" not at start of string | |
495 | $x =~ /^Who/m; # matches, "Who" at start of second line | |
496 | $x =~ /^Who/sm; # matches, "Who" at start of second line | |
497 | ||
498 | $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n" | |
499 | $x =~ /girl.Who/s; # matches, "." matches "\n" | |
500 | $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n" | |
501 | $x =~ /girl.Who/sm; # matches, "." matches "\n" | |
502 | ||
503 | Most of the time, the default behavior is what is want, but C<//s> and | |
504 | C<//m> are occasionally very useful. If C<//m> is being used, the start | |
505 | of the string can still be matched with C<\A> and the end of string | |
506 | can still be matched with the anchors C<\Z> (matches both the end and | |
507 | the newline before, like C<$>), and C<\z> (matches only the end): | |
508 | ||
509 | $x =~ /^Who/m; # matches, "Who" at start of second line | |
510 | $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string | |
511 | ||
512 | $x =~ /girl$/m; # matches, "girl" at end of first line | |
513 | $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string | |
514 | ||
515 | $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end | |
516 | $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string | |
517 | ||
518 | We now know how to create choices among classes of characters in a | |
519 | regexp. What about choices among words or character strings? Such | |
520 | choices are described in the next section. | |
521 | ||
522 | =head2 Matching this or that | |
523 | ||
524 | Sometimes we would like to our regexp to be able to match different | |
525 | possible words or character strings. This is accomplished by using | |
526 | the B<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we | |
527 | form the regexp C<dog|cat>. As before, perl will try to match the | |
528 | regexp at the earliest possible point in the string. At each | |
529 | character position, perl will first try to match the first | |
530 | alternative, C<dog>. If C<dog> doesn't match, perl will then try the | |
531 | next alternative, C<cat>. If C<cat> doesn't match either, then the | |
532 | match fails and perl moves to the next position in the string. Some | |
533 | examples: | |
534 | ||
535 | "cats and dogs" =~ /cat|dog|bird/; # matches "cat" | |
536 | "cats and dogs" =~ /dog|cat|bird/; # matches "cat" | |
537 | ||
538 | Even though C<dog> is the first alternative in the second regexp, | |
539 | C<cat> is able to match earlier in the string. | |
540 | ||
541 | "cats" =~ /c|ca|cat|cats/; # matches "c" | |
542 | "cats" =~ /cats|cat|ca|c/; # matches "cats" | |
543 | ||
544 | Here, all the alternatives match at the first string position, so the | |
545 | first alternative is the one that matches. If some of the | |
546 | alternatives are truncations of the others, put the longest ones first | |
547 | to give them a chance to match. | |
548 | ||
549 | "cab" =~ /a|b|c/ # matches "c" | |
550 | # /a|b|c/ == /[abc]/ | |
551 | ||
552 | The last example points out that character classes are like | |
553 | alternations of characters. At a given character position, the first | |
210b36aa | 554 | alternative that allows the regexp match to succeed will be the one |
47f9c88b GS |
555 | that matches. |
556 | ||
557 | =head2 Grouping things and hierarchical matching | |
558 | ||
559 | Alternation allows a regexp to choose among alternatives, but by | |
560 | itself it unsatisfying. The reason is that each alternative is a whole | |
561 | regexp, but sometime we want alternatives for just part of a | |
562 | regexp. For instance, suppose we want to search for housecats or | |
563 | housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is | |
564 | inefficient because we had to type C<house> twice. It would be nice to | |
da75cd15 | 565 | have parts of the regexp be constant, like C<house>, and some |
47f9c88b GS |
566 | parts have alternatives, like C<cat|keeper>. |
567 | ||
568 | The B<grouping> metacharacters C<()> solve this problem. Grouping | |
569 | allows parts of a regexp to be treated as a single unit. Parts of a | |
570 | regexp are grouped by enclosing them in parentheses. Thus we could solve | |
571 | the C<housecat|housekeeper> by forming the regexp as | |
572 | C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match | |
573 | C<house> followed by either C<cat> or C<keeper>. Some more examples | |
574 | are | |
575 | ||
576 | /(a|b)b/; # matches 'ab' or 'bb' | |
577 | /(ac|b)b/; # matches 'acb' or 'bb' | |
578 | /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere | |
579 | /(a|[bc])d/; # matches 'ad', 'bd', or 'cd' | |
580 | ||
581 | /house(cat|)/; # matches either 'housecat' or 'house' | |
582 | /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or | |
583 | # 'house'. Note groups can be nested. | |
584 | ||
585 | /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx | |
586 | "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d', | |
587 | # because '20\d\d' can't match | |
588 | ||
589 | Alternations behave the same way in groups as out of them: at a given | |
590 | string position, the leftmost alternative that allows the regexp to | |
210b36aa | 591 | match is taken. So in the last example at the first string position, |
47f9c88b GS |
592 | C<"20"> matches the second alternative, but there is nothing left over |
593 | to match the next two digits C<\d\d>. So perl moves on to the next | |
594 | alternative, which is the null alternative and that works, since | |
595 | C<"20"> is two digits. | |
596 | ||
597 | The process of trying one alternative, seeing if it matches, and | |
598 | moving on to the next alternative if it doesn't, is called | |
599 | B<backtracking>. The term 'backtracking' comes from the idea that | |
600 | matching a regexp is like a walk in the woods. Successfully matching | |
601 | a regexp is like arriving at a destination. There are many possible | |
602 | trailheads, one for each string position, and each one is tried in | |
603 | order, left to right. From each trailhead there may be many paths, | |
604 | some of which get you there, and some which are dead ends. When you | |
605 | walk along a trail and hit a dead end, you have to backtrack along the | |
606 | trail to an earlier point to try another trail. If you hit your | |
607 | destination, you stop immediately and forget about trying all the | |
608 | other trails. You are persistent, and only if you have tried all the | |
609 | trails from all the trailheads and not arrived at your destination, do | |
610 | you declare failure. To be concrete, here is a step-by-step analysis | |
611 | of what perl does when it tries to match the regexp | |
612 | ||
613 | "abcde" =~ /(abd|abc)(df|d|de)/; | |
614 | ||
615 | =over 4 | |
616 | ||
551e1d92 RB |
617 | =item 0 |
618 | ||
619 | Start with the first letter in the string 'a'. | |
620 | ||
621 | =item 1 | |
47f9c88b | 622 | |
551e1d92 | 623 | Try the first alternative in the first group 'abd'. |
47f9c88b | 624 | |
551e1d92 | 625 | =item 2 |
47f9c88b | 626 | |
551e1d92 RB |
627 | Match 'a' followed by 'b'. So far so good. |
628 | ||
629 | =item 3 | |
630 | ||
631 | 'd' in the regexp doesn't match 'c' in the string - a dead | |
47f9c88b GS |
632 | end. So backtrack two characters and pick the second alternative in |
633 | the first group 'abc'. | |
634 | ||
551e1d92 RB |
635 | =item 4 |
636 | ||
637 | Match 'a' followed by 'b' followed by 'c'. We are on a roll | |
47f9c88b GS |
638 | and have satisfied the first group. Set $1 to 'abc'. |
639 | ||
551e1d92 RB |
640 | =item 5 |
641 | ||
642 | Move on to the second group and pick the first alternative | |
47f9c88b GS |
643 | 'df'. |
644 | ||
551e1d92 | 645 | =item 6 |
47f9c88b | 646 | |
551e1d92 RB |
647 | Match the 'd'. |
648 | ||
649 | =item 7 | |
650 | ||
651 | 'f' in the regexp doesn't match 'e' in the string, so a dead | |
47f9c88b GS |
652 | end. Backtrack one character and pick the second alternative in the |
653 | second group 'd'. | |
654 | ||
551e1d92 RB |
655 | =item 8 |
656 | ||
657 | 'd' matches. The second grouping is satisfied, so set $2 to | |
47f9c88b GS |
658 | 'd'. |
659 | ||
551e1d92 RB |
660 | =item 9 |
661 | ||
662 | We are at the end of the regexp, so we are done! We have | |
47f9c88b GS |
663 | matched 'abcd' out of the string "abcde". |
664 | ||
665 | =back | |
666 | ||
667 | There are a couple of things to note about this analysis. First, the | |
668 | third alternative in the second group 'de' also allows a match, but we | |
669 | stopped before we got to it - at a given character position, leftmost | |
670 | wins. Second, we were able to get a match at the first character | |
671 | position of the string 'a'. If there were no matches at the first | |
672 | position, perl would move to the second character position 'b' and | |
673 | attempt the match all over again. Only when all possible paths at all | |
da75cd15 | 674 | possible character positions have been exhausted does perl give |
47f9c88b GS |
675 | up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;> > to be false. |
676 | ||
677 | Even with all this work, regexp matching happens remarkably fast. To | |
678 | speed things up, during compilation stage, perl compiles the regexp | |
679 | into a compact sequence of opcodes that can often fit inside a | |
680 | processor cache. When the code is executed, these opcodes can then run | |
681 | at full throttle and search very quickly. | |
682 | ||
683 | =head2 Extracting matches | |
684 | ||
685 | The grouping metacharacters C<()> also serve another completely | |
686 | different function: they allow the extraction of the parts of a string | |
687 | that matched. This is very useful to find out what matched and for | |
688 | text processing in general. For each grouping, the part that matched | |
689 | inside goes into the special variables C<$1>, C<$2>, etc. They can be | |
690 | used just as ordinary variables: | |
691 | ||
692 | # extract hours, minutes, seconds | |
2275acdc RGS |
693 | if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format |
694 | $hours = $1; | |
695 | $minutes = $2; | |
696 | $seconds = $3; | |
697 | } | |
47f9c88b GS |
698 | |
699 | Now, we know that in scalar context, | |
700 | S<C<$time =~ /(\d\d):(\d\d):(\d\d)/> > returns a true or false | |
701 | value. In list context, however, it returns the list of matched values | |
702 | C<($1,$2,$3)>. So we could write the code more compactly as | |
703 | ||
704 | # extract hours, minutes, seconds | |
705 | ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/); | |
706 | ||
707 | If the groupings in a regexp are nested, C<$1> gets the group with the | |
708 | leftmost opening parenthesis, C<$2> the next opening parenthesis, | |
709 | etc. For example, here is a complex regexp and the matching variables | |
710 | indicated below it: | |
711 | ||
712 | /(ab(cd|ef)((gi)|j))/; | |
713 | 1 2 34 | |
714 | ||
a01268b5 JH |
715 | so that if the regexp matched, e.g., C<$2> would contain 'cd' or 'ef'. For |
716 | convenience, perl sets C<$+> to the string held by the highest numbered | |
717 | C<$1>, C<$2>, ... that got assigned (and, somewhat related, C<$^N> to the | |
718 | value of the C<$1>, C<$2>, ... most-recently assigned; i.e. the C<$1>, | |
719 | C<$2>, ... associated with the rightmost closing parenthesis used in the | |
720 | match). | |
47f9c88b GS |
721 | |
722 | Closely associated with the matching variables C<$1>, C<$2>, ... are | |
723 | the B<backreferences> C<\1>, C<\2>, ... . Backreferences are simply | |
724 | matching variables that can be used I<inside> a regexp. This is a | |
725 | really nice feature - what matches later in a regexp can depend on | |
726 | what matched earlier in the regexp. Suppose we wanted to look | |
727 | for doubled words in text, like 'the the'. The following regexp finds | |
728 | all 3-letter doubles with a space in between: | |
729 | ||
730 | /(\w\w\w)\s\1/; | |
731 | ||
732 | The grouping assigns a value to \1, so that the same 3 letter sequence | |
733 | is used for both parts. Here are some words with repeated parts: | |
734 | ||
735 | % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words | |
736 | beriberi | |
737 | booboo | |
738 | coco | |
739 | mama | |
740 | murmur | |
741 | papa | |
742 | ||
743 | The regexp has a single grouping which considers 4-letter | |
744 | combinations, then 3-letter combinations, etc. and uses C<\1> to look for | |
745 | a repeat. Although C<$1> and C<\1> represent the same thing, care should be | |
746 | taken to use matched variables C<$1>, C<$2>, ... only outside a regexp | |
747 | and backreferences C<\1>, C<\2>, ... only inside a regexp; not doing | |
748 | so may lead to surprising and/or undefined results. | |
749 | ||
750 | In addition to what was matched, Perl 5.6.0 also provides the | |
751 | positions of what was matched with the C<@-> and C<@+> | |
752 | arrays. C<$-[0]> is the position of the start of the entire match and | |
753 | C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the | |
754 | position of the start of the C<$n> match and C<$+[n]> is the position | |
755 | of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then | |
756 | this code | |
757 | ||
758 | $x = "Mmm...donut, thought Homer"; | |
759 | $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches | |
760 | foreach $expr (1..$#-) { | |
761 | print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n"; | |
762 | } | |
763 | ||
764 | prints | |
765 | ||
766 | Match 1: 'Mmm' at position (0,3) | |
767 | Match 2: 'donut' at position (6,11) | |
768 | ||
769 | Even if there are no groupings in a regexp, it is still possible to | |
770 | find out what exactly matched in a string. If you use them, perl | |
771 | will set C<$`> to the part of the string before the match, will set C<$&> | |
772 | to the part of the string that matched, and will set C<$'> to the part | |
773 | of the string after the match. An example: | |
774 | ||
775 | $x = "the cat caught the mouse"; | |
776 | $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse' | |
777 | $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse' | |
778 | ||
779 | In the second match, S<C<$` = ''> > because the regexp matched at the | |
780 | first character position in the string and stopped, it never saw the | |
781 | second 'the'. It is important to note that using C<$`> and C<$'> | |
a6b2f353 | 782 | slows down regexp matching quite a bit, and C< $& > slows it down to a |
47f9c88b GS |
783 | lesser extent, because if they are used in one regexp in a program, |
784 | they are generated for <all> regexps in the program. So if raw | |
785 | performance is a goal of your application, they should be avoided. | |
786 | If you need them, use C<@-> and C<@+> instead: | |
787 | ||
788 | $` is the same as substr( $x, 0, $-[0] ) | |
789 | $& is the same as substr( $x, $-[0], $+[0]-$-[0] ) | |
790 | $' is the same as substr( $x, $+[0] ) | |
791 | ||
792 | =head2 Matching repetitions | |
793 | ||
794 | The examples in the previous section display an annoying weakness. We | |
795 | were only matching 3-letter words, or syllables of 4 letters or | |
796 | less. We'd like to be able to match words or syllables of any length, | |
797 | without writing out tedious alternatives like | |
798 | C<\w\w\w\w|\w\w\w|\w\w|\w>. | |
799 | ||
800 | This is exactly the problem the B<quantifier> metacharacters C<?>, | |
801 | C<*>, C<+>, and C<{}> were created for. They allow us to determine the | |
802 | number of repeats of a portion of a regexp we consider to be a | |
803 | match. Quantifiers are put immediately after the character, character | |
804 | class, or grouping that we want to specify. They have the following | |
805 | meanings: | |
806 | ||
807 | =over 4 | |
808 | ||
551e1d92 | 809 | =item * |
47f9c88b | 810 | |
551e1d92 | 811 | C<a?> = match 'a' 1 or 0 times |
47f9c88b | 812 | |
551e1d92 RB |
813 | =item * |
814 | ||
815 | C<a*> = match 'a' 0 or more times, i.e., any number of times | |
816 | ||
817 | =item * | |
47f9c88b | 818 | |
551e1d92 RB |
819 | C<a+> = match 'a' 1 or more times, i.e., at least once |
820 | ||
821 | =item * | |
822 | ||
823 | C<a{n,m}> = match at least C<n> times, but not more than C<m> | |
47f9c88b GS |
824 | times. |
825 | ||
551e1d92 RB |
826 | =item * |
827 | ||
828 | C<a{n,}> = match at least C<n> or more times | |
829 | ||
830 | =item * | |
47f9c88b | 831 | |
551e1d92 | 832 | C<a{n}> = match exactly C<n> times |
47f9c88b GS |
833 | |
834 | =back | |
835 | ||
836 | Here are some examples: | |
837 | ||
838 | /[a-z]+\s+\d*/; # match a lowercase word, at least some space, and | |
839 | # any number of digits | |
840 | /(\w+)\s+\1/; # match doubled words of arbitrary length | |
841 | /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes' | |
842 | $year =~ /\d{2,4}/; # make sure year is at least 2 but not more | |
843 | # than 4 digits | |
844 | $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates | |
845 | $year =~ /\d{2}(\d{2})?/; # same thing written differently. However, | |
846 | # this produces $1 and the other does not. | |
847 | ||
848 | % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier? | |
849 | beriberi | |
850 | booboo | |
851 | coco | |
852 | mama | |
853 | murmur | |
854 | papa | |
855 | ||
856 | For all of these quantifiers, perl will try to match as much of the | |
857 | string as possible, while still allowing the regexp to succeed. Thus | |
858 | with C</a?.../>, perl will first try to match the regexp with the C<a> | |
859 | present; if that fails, perl will try to match the regexp without the | |
860 | C<a> present. For the quantifier C<*>, we get the following: | |
861 | ||
862 | $x = "the cat in the hat"; | |
863 | $x =~ /^(.*)(cat)(.*)$/; # matches, | |
864 | # $1 = 'the ' | |
865 | # $2 = 'cat' | |
866 | # $3 = ' in the hat' | |
867 | ||
868 | Which is what we might expect, the match finds the only C<cat> in the | |
869 | string and locks onto it. Consider, however, this regexp: | |
870 | ||
871 | $x =~ /^(.*)(at)(.*)$/; # matches, | |
872 | # $1 = 'the cat in the h' | |
873 | # $2 = 'at' | |
874 | # $3 = '' (0 matches) | |
875 | ||
876 | One might initially guess that perl would find the C<at> in C<cat> and | |
877 | stop there, but that wouldn't give the longest possible string to the | |
878 | first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as | |
879 | much of the string as possible while still having the regexp match. In | |
a6b2f353 | 880 | this example, that means having the C<at> sequence with the final C<at> |
47f9c88b GS |
881 | in the string. The other important principle illustrated here is that |
882 | when there are two or more elements in a regexp, the I<leftmost> | |
883 | quantifier, if there is one, gets to grab as much the string as | |
884 | possible, leaving the rest of the regexp to fight over scraps. Thus in | |
885 | our example, the first quantifier C<.*> grabs most of the string, while | |
886 | the second quantifier C<.*> gets the empty string. Quantifiers that | |
887 | grab as much of the string as possible are called B<maximal match> or | |
888 | B<greedy> quantifiers. | |
889 | ||
890 | When a regexp can match a string in several different ways, we can use | |
891 | the principles above to predict which way the regexp will match: | |
892 | ||
893 | =over 4 | |
894 | ||
895 | =item * | |
551e1d92 | 896 | |
47f9c88b GS |
897 | Principle 0: Taken as a whole, any regexp will be matched at the |
898 | earliest possible position in the string. | |
899 | ||
900 | =item * | |
551e1d92 | 901 | |
47f9c88b GS |
902 | Principle 1: In an alternation C<a|b|c...>, the leftmost alternative |
903 | that allows a match for the whole regexp will be the one used. | |
904 | ||
905 | =item * | |
551e1d92 | 906 | |
47f9c88b GS |
907 | Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and |
908 | C<{n,m}> will in general match as much of the string as possible while | |
909 | still allowing the whole regexp to match. | |
910 | ||
911 | =item * | |
551e1d92 | 912 | |
47f9c88b GS |
913 | Principle 3: If there are two or more elements in a regexp, the |
914 | leftmost greedy quantifier, if any, will match as much of the string | |
915 | as possible while still allowing the whole regexp to match. The next | |
916 | leftmost greedy quantifier, if any, will try to match as much of the | |
917 | string remaining available to it as possible, while still allowing the | |
918 | whole regexp to match. And so on, until all the regexp elements are | |
919 | satisfied. | |
920 | ||
921 | =back | |
922 | ||
923 | As we have seen above, Principle 0 overrides the others - the regexp | |
924 | will be matched as early as possible, with the other principles | |
925 | determining how the regexp matches at that earliest character | |
926 | position. | |
927 | ||
928 | Here is an example of these principles in action: | |
929 | ||
930 | $x = "The programming republic of Perl"; | |
931 | $x =~ /^(.+)(e|r)(.*)$/; # matches, | |
932 | # $1 = 'The programming republic of Pe' | |
933 | # $2 = 'r' | |
934 | # $3 = 'l' | |
935 | ||
936 | This regexp matches at the earliest string position, C<'T'>. One | |
937 | might think that C<e>, being leftmost in the alternation, would be | |
938 | matched, but C<r> produces the longest string in the first quantifier. | |
939 | ||
940 | $x =~ /(m{1,2})(.*)$/; # matches, | |
941 | # $1 = 'mm' | |
942 | # $2 = 'ing republic of Perl' | |
943 | ||
944 | Here, The earliest possible match is at the first C<'m'> in | |
945 | C<programming>. C<m{1,2}> is the first quantifier, so it gets to match | |
946 | a maximal C<mm>. | |
947 | ||
948 | $x =~ /.*(m{1,2})(.*)$/; # matches, | |
949 | # $1 = 'm' | |
950 | # $2 = 'ing republic of Perl' | |
951 | ||
952 | Here, the regexp matches at the start of the string. The first | |
953 | quantifier C<.*> grabs as much as possible, leaving just a single | |
954 | C<'m'> for the second quantifier C<m{1,2}>. | |
955 | ||
956 | $x =~ /(.?)(m{1,2})(.*)$/; # matches, | |
957 | # $1 = 'a' | |
958 | # $2 = 'mm' | |
959 | # $3 = 'ing republic of Perl' | |
960 | ||
961 | Here, C<.?> eats its maximal one character at the earliest possible | |
962 | position in the string, C<'a'> in C<programming>, leaving C<m{1,2}> | |
963 | the opportunity to match both C<m>'s. Finally, | |
964 | ||
965 | "aXXXb" =~ /(X*)/; # matches with $1 = '' | |
966 | ||
967 | because it can match zero copies of C<'X'> at the beginning of the | |
968 | string. If you definitely want to match at least one C<'X'>, use | |
969 | C<X+>, not C<X*>. | |
970 | ||
971 | Sometimes greed is not good. At times, we would like quantifiers to | |
972 | match a I<minimal> piece of string, rather than a maximal piece. For | |
973 | this purpose, Larry Wall created the S<B<minimal match> > or | |
974 | B<non-greedy> quantifiers C<??>,C<*?>, C<+?>, and C<{}?>. These are | |
975 | the usual quantifiers with a C<?> appended to them. They have the | |
976 | following meanings: | |
977 | ||
978 | =over 4 | |
979 | ||
551e1d92 RB |
980 | =item * |
981 | ||
982 | C<a??> = match 'a' 0 or 1 times. Try 0 first, then 1. | |
47f9c88b | 983 | |
551e1d92 RB |
984 | =item * |
985 | ||
986 | C<a*?> = match 'a' 0 or more times, i.e., any number of times, | |
47f9c88b GS |
987 | but as few times as possible |
988 | ||
551e1d92 RB |
989 | =item * |
990 | ||
991 | C<a+?> = match 'a' 1 or more times, i.e., at least once, but | |
47f9c88b GS |
992 | as few times as possible |
993 | ||
551e1d92 RB |
994 | =item * |
995 | ||
996 | C<a{n,m}?> = match at least C<n> times, not more than C<m> | |
47f9c88b GS |
997 | times, as few times as possible |
998 | ||
551e1d92 RB |
999 | =item * |
1000 | ||
1001 | C<a{n,}?> = match at least C<n> times, but as few times as | |
47f9c88b GS |
1002 | possible |
1003 | ||
551e1d92 RB |
1004 | =item * |
1005 | ||
1006 | C<a{n}?> = match exactly C<n> times. Because we match exactly | |
47f9c88b GS |
1007 | C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for |
1008 | notational consistency. | |
1009 | ||
1010 | =back | |
1011 | ||
1012 | Let's look at the example above, but with minimal quantifiers: | |
1013 | ||
1014 | $x = "The programming republic of Perl"; | |
1015 | $x =~ /^(.+?)(e|r)(.*)$/; # matches, | |
1016 | # $1 = 'Th' | |
1017 | # $2 = 'e' | |
1018 | # $3 = ' programming republic of Perl' | |
1019 | ||
1020 | The minimal string that will allow both the start of the string C<^> | |
1021 | and the alternation to match is C<Th>, with the alternation C<e|r> | |
1022 | matching C<e>. The second quantifier C<.*> is free to gobble up the | |
1023 | rest of the string. | |
1024 | ||
1025 | $x =~ /(m{1,2}?)(.*?)$/; # matches, | |
1026 | # $1 = 'm' | |
1027 | # $2 = 'ming republic of Perl' | |
1028 | ||
1029 | The first string position that this regexp can match is at the first | |
1030 | C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?> | |
1031 | matches just one C<'m'>. Although the second quantifier C<.*?> would | |
1032 | prefer to match no characters, it is constrained by the end-of-string | |
1033 | anchor C<$> to match the rest of the string. | |
1034 | ||
1035 | $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches, | |
1036 | # $1 = 'The progra' | |
1037 | # $2 = 'm' | |
1038 | # $3 = 'ming republic of Perl' | |
1039 | ||
1040 | In this regexp, you might expect the first minimal quantifier C<.*?> | |
1041 | to match the empty string, because it is not constrained by a C<^> | |
1042 | anchor to match the beginning of the word. Principle 0 applies here, | |
1043 | however. Because it is possible for the whole regexp to match at the | |
1044 | start of the string, it I<will> match at the start of the string. Thus | |
1045 | the first quantifier has to match everything up to the first C<m>. The | |
1046 | second minimal quantifier matches just one C<m> and the third | |
1047 | quantifier matches the rest of the string. | |
1048 | ||
1049 | $x =~ /(.??)(m{1,2})(.*)$/; # matches, | |
1050 | # $1 = 'a' | |
1051 | # $2 = 'mm' | |
1052 | # $3 = 'ing republic of Perl' | |
1053 | ||
1054 | Just as in the previous regexp, the first quantifier C<.??> can match | |
1055 | earliest at position C<'a'>, so it does. The second quantifier is | |
1056 | greedy, so it matches C<mm>, and the third matches the rest of the | |
1057 | string. | |
1058 | ||
1059 | We can modify principle 3 above to take into account non-greedy | |
1060 | quantifiers: | |
1061 | ||
1062 | =over 4 | |
1063 | ||
1064 | =item * | |
551e1d92 | 1065 | |
47f9c88b GS |
1066 | Principle 3: If there are two or more elements in a regexp, the |
1067 | leftmost greedy (non-greedy) quantifier, if any, will match as much | |
1068 | (little) of the string as possible while still allowing the whole | |
1069 | regexp to match. The next leftmost greedy (non-greedy) quantifier, if | |
1070 | any, will try to match as much (little) of the string remaining | |
1071 | available to it as possible, while still allowing the whole regexp to | |
1072 | match. And so on, until all the regexp elements are satisfied. | |
1073 | ||
1074 | =back | |
1075 | ||
1076 | Just like alternation, quantifiers are also susceptible to | |
1077 | backtracking. Here is a step-by-step analysis of the example | |
1078 | ||
1079 | $x = "the cat in the hat"; | |
1080 | $x =~ /^(.*)(at)(.*)$/; # matches, | |
1081 | # $1 = 'the cat in the h' | |
1082 | # $2 = 'at' | |
1083 | # $3 = '' (0 matches) | |
1084 | ||
1085 | =over 4 | |
1086 | ||
551e1d92 RB |
1087 | =item 0 |
1088 | ||
1089 | Start with the first letter in the string 't'. | |
47f9c88b | 1090 | |
551e1d92 RB |
1091 | =item 1 |
1092 | ||
1093 | The first quantifier '.*' starts out by matching the whole | |
47f9c88b GS |
1094 | string 'the cat in the hat'. |
1095 | ||
551e1d92 RB |
1096 | =item 2 |
1097 | ||
1098 | 'a' in the regexp element 'at' doesn't match the end of the | |
47f9c88b GS |
1099 | string. Backtrack one character. |
1100 | ||
551e1d92 RB |
1101 | =item 3 |
1102 | ||
1103 | 'a' in the regexp element 'at' still doesn't match the last | |
47f9c88b GS |
1104 | letter of the string 't', so backtrack one more character. |
1105 | ||
551e1d92 RB |
1106 | =item 4 |
1107 | ||
1108 | Now we can match the 'a' and the 't'. | |
47f9c88b | 1109 | |
551e1d92 RB |
1110 | =item 5 |
1111 | ||
1112 | Move on to the third element '.*'. Since we are at the end of | |
47f9c88b GS |
1113 | the string and '.*' can match 0 times, assign it the empty string. |
1114 | ||
551e1d92 RB |
1115 | =item 6 |
1116 | ||
1117 | We are done! | |
47f9c88b GS |
1118 | |
1119 | =back | |
1120 | ||
1121 | Most of the time, all this moving forward and backtracking happens | |
1122 | quickly and searching is fast. There are some pathological regexps, | |
1123 | however, whose execution time exponentially grows with the size of the | |
1124 | string. A typical structure that blows up in your face is of the form | |
1125 | ||
1126 | /(a|b+)*/; | |
1127 | ||
1128 | The problem is the nested indeterminate quantifiers. There are many | |
1129 | different ways of partitioning a string of length n between the C<+> | |
1130 | and C<*>: one repetition with C<b+> of length n, two repetitions with | |
1131 | the first C<b+> length k and the second with length n-k, m repetitions | |
1132 | whose bits add up to length n, etc. In fact there are an exponential | |
1133 | number of ways to partition a string as a function of length. A | |
1134 | regexp may get lucky and match early in the process, but if there is | |
1135 | no match, perl will try I<every> possibility before giving up. So be | |
1136 | careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book | |
1137 | I<Mastering regular expressions> by Jeffrey Friedl gives a wonderful | |
1138 | discussion of this and other efficiency issues. | |
1139 | ||
1140 | =head2 Building a regexp | |
1141 | ||
1142 | At this point, we have all the basic regexp concepts covered, so let's | |
1143 | give a more involved example of a regular expression. We will build a | |
1144 | regexp that matches numbers. | |
1145 | ||
1146 | The first task in building a regexp is to decide what we want to match | |
1147 | and what we want to exclude. In our case, we want to match both | |
1148 | integers and floating point numbers and we want to reject any string | |
1149 | that isn't a number. | |
1150 | ||
1151 | The next task is to break the problem down into smaller problems that | |
1152 | are easily converted into a regexp. | |
1153 | ||
1154 | The simplest case is integers. These consist of a sequence of digits, | |
1155 | with an optional sign in front. The digits we can represent with | |
1156 | C<\d+> and the sign can be matched with C<[+-]>. Thus the integer | |
1157 | regexp is | |
1158 | ||
1159 | /[+-]?\d+/; # matches integers | |
1160 | ||
1161 | A floating point number potentially has a sign, an integral part, a | |
1162 | decimal point, a fractional part, and an exponent. One or more of these | |
1163 | parts is optional, so we need to check out the different | |
1164 | possibilities. Floating point numbers which are in proper form include | |
1165 | 123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out | |
1166 | front is completely optional and can be matched by C<[+-]?>. We can | |
1167 | see that if there is no exponent, floating point numbers must have a | |
1168 | decimal point, otherwise they are integers. We might be tempted to | |
1169 | model these with C<\d*\.\d*>, but this would also match just a single | |
1170 | decimal point, which is not a number. So the three cases of floating | |
1171 | point number sans exponent are | |
1172 | ||
1173 | /[+-]?\d+\./; # 1., 321., etc. | |
1174 | /[+-]?\.\d+/; # .1, .234, etc. | |
1175 | /[+-]?\d+\.\d+/; # 1.0, 30.56, etc. | |
1176 | ||
1177 | These can be combined into a single regexp with a three-way alternation: | |
1178 | ||
1179 | /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent | |
1180 | ||
1181 | In this alternation, it is important to put C<'\d+\.\d+'> before | |
1182 | C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that | |
1183 | and ignore the fractional part of the number. | |
1184 | ||
1185 | Now consider floating point numbers with exponents. The key | |
1186 | observation here is that I<both> integers and numbers with decimal | |
1187 | points are allowed in front of an exponent. Then exponents, like the | |
1188 | overall sign, are independent of whether we are matching numbers with | |
1189 | or without decimal points, and can be 'decoupled' from the | |
1190 | mantissa. The overall form of the regexp now becomes clear: | |
1191 | ||
1192 | /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/; | |
1193 | ||
1194 | The exponent is an C<e> or C<E>, followed by an integer. So the | |
1195 | exponent regexp is | |
1196 | ||
1197 | /[eE][+-]?\d+/; # exponent | |
1198 | ||
1199 | Putting all the parts together, we get a regexp that matches numbers: | |
1200 | ||
1201 | /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da! | |
1202 | ||
1203 | Long regexps like this may impress your friends, but can be hard to | |
1204 | decipher. In complex situations like this, the C<//x> modifier for a | |
1205 | match is invaluable. It allows one to put nearly arbitrary whitespace | |
1206 | and comments into a regexp without affecting their meaning. Using it, | |
1207 | we can rewrite our 'extended' regexp in the more pleasing form | |
1208 | ||
1209 | /^ | |
1210 | [+-]? # first, match an optional sign | |
1211 | ( # then match integers or f.p. mantissas: | |
1212 | \d+\.\d+ # mantissa of the form a.b | |
1213 | |\d+\. # mantissa of the form a. | |
1214 | |\.\d+ # mantissa of the form .b | |
1215 | |\d+ # integer of the form a | |
1216 | ) | |
1217 | ([eE][+-]?\d+)? # finally, optionally match an exponent | |
1218 | $/x; | |
1219 | ||
1220 | If whitespace is mostly irrelevant, how does one include space | |
1221 | characters in an extended regexp? The answer is to backslash it | |
1222 | S<C<'\ '> > or put it in a character class S<C<[ ]> >. The same thing | |
1223 | goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows | |
1224 | a space between the sign and the mantissa/integer, and we could add | |
1225 | this to our regexp as follows: | |
1226 | ||
1227 | /^ | |
1228 | [+-]?\ * # first, match an optional sign *and space* | |
1229 | ( # then match integers or f.p. mantissas: | |
1230 | \d+\.\d+ # mantissa of the form a.b | |
1231 | |\d+\. # mantissa of the form a. | |
1232 | |\.\d+ # mantissa of the form .b | |
1233 | |\d+ # integer of the form a | |
1234 | ) | |
1235 | ([eE][+-]?\d+)? # finally, optionally match an exponent | |
1236 | $/x; | |
1237 | ||
1238 | In this form, it is easier to see a way to simplify the | |
1239 | alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it | |
1240 | could be factored out: | |
1241 | ||
1242 | /^ | |
1243 | [+-]?\ * # first, match an optional sign | |
1244 | ( # then match integers or f.p. mantissas: | |
1245 | \d+ # start out with a ... | |
1246 | ( | |
1247 | \.\d* # mantissa of the form a.b or a. | |
1248 | )? # ? takes care of integers of the form a | |
1249 | |\.\d+ # mantissa of the form .b | |
1250 | ) | |
1251 | ([eE][+-]?\d+)? # finally, optionally match an exponent | |
1252 | $/x; | |
1253 | ||
1254 | or written in the compact form, | |
1255 | ||
1256 | /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/; | |
1257 | ||
1258 | This is our final regexp. To recap, we built a regexp by | |
1259 | ||
1260 | =over 4 | |
1261 | ||
551e1d92 RB |
1262 | =item * |
1263 | ||
1264 | specifying the task in detail, | |
47f9c88b | 1265 | |
551e1d92 RB |
1266 | =item * |
1267 | ||
1268 | breaking down the problem into smaller parts, | |
1269 | ||
1270 | =item * | |
47f9c88b | 1271 | |
551e1d92 | 1272 | translating the small parts into regexps, |
47f9c88b | 1273 | |
551e1d92 RB |
1274 | =item * |
1275 | ||
1276 | combining the regexps, | |
1277 | ||
1278 | =item * | |
47f9c88b | 1279 | |
551e1d92 | 1280 | and optimizing the final combined regexp. |
47f9c88b GS |
1281 | |
1282 | =back | |
1283 | ||
1284 | These are also the typical steps involved in writing a computer | |
1285 | program. This makes perfect sense, because regular expressions are | |
1286 | essentially programs written a little computer language that specifies | |
1287 | patterns. | |
1288 | ||
1289 | =head2 Using regular expressions in Perl | |
1290 | ||
1291 | The last topic of Part 1 briefly covers how regexps are used in Perl | |
1292 | programs. Where do they fit into Perl syntax? | |
1293 | ||
1294 | We have already introduced the matching operator in its default | |
1295 | C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used | |
1296 | the binding operator C<=~> and its negation C<!~> to test for string | |
1297 | matches. Associated with the matching operator, we have discussed the | |
1298 | single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and | |
1299 | extended C<//x> modifiers. | |
1300 | ||
1301 | There are a few more things you might want to know about matching | |
1302 | operators. First, we pointed out earlier that variables in regexps are | |
1303 | substituted before the regexp is evaluated: | |
1304 | ||
1305 | $pattern = 'Seuss'; | |
1306 | while (<>) { | |
1307 | print if /$pattern/; | |
1308 | } | |
1309 | ||
1310 | This will print any lines containing the word C<Seuss>. It is not as | |
1311 | efficient as it could be, however, because perl has to re-evaluate | |
1312 | C<$pattern> each time through the loop. If C<$pattern> won't be | |
1313 | changing over the lifetime of the script, we can add the C<//o> | |
1314 | modifier, which directs perl to only perform variable substitutions | |
1315 | once: | |
1316 | ||
1317 | #!/usr/bin/perl | |
1318 | # Improved simple_grep | |
1319 | $regexp = shift; | |
1320 | while (<>) { | |
1321 | print if /$regexp/o; # a good deal faster | |
1322 | } | |
1323 | ||
1324 | If you change C<$pattern> after the first substitution happens, perl | |
1325 | will ignore it. If you don't want any substitutions at all, use the | |
1326 | special delimiter C<m''>: | |
1327 | ||
16e8b840 | 1328 | @pattern = ('Seuss'); |
47f9c88b | 1329 | while (<>) { |
16e8b840 | 1330 | print if m'@pattern'; # matches literal '@pattern', not 'Seuss' |
47f9c88b GS |
1331 | } |
1332 | ||
1333 | C<m''> acts like single quotes on a regexp; all other C<m> delimiters | |
1334 | act like double quotes. If the regexp evaluates to the empty string, | |
1335 | the regexp in the I<last successful match> is used instead. So we have | |
1336 | ||
1337 | "dog" =~ /d/; # 'd' matches | |
1338 | "dogbert =~ //; # this matches the 'd' regexp used before | |
1339 | ||
1340 | The final two modifiers C<//g> and C<//c> concern multiple matches. | |
da75cd15 | 1341 | The modifier C<//g> stands for global matching and allows the |
47f9c88b GS |
1342 | matching operator to match within a string as many times as possible. |
1343 | In scalar context, successive invocations against a string will have | |
1344 | `C<//g> jump from match to match, keeping track of position in the | |
1345 | string as it goes along. You can get or set the position with the | |
1346 | C<pos()> function. | |
1347 | ||
1348 | The use of C<//g> is shown in the following example. Suppose we have | |
1349 | a string that consists of words separated by spaces. If we know how | |
1350 | many words there are in advance, we could extract the words using | |
1351 | groupings: | |
1352 | ||
1353 | $x = "cat dog house"; # 3 words | |
1354 | $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches, | |
1355 | # $1 = 'cat' | |
1356 | # $2 = 'dog' | |
1357 | # $3 = 'house' | |
1358 | ||
1359 | But what if we had an indeterminate number of words? This is the sort | |
1360 | of task C<//g> was made for. To extract all words, form the simple | |
1361 | regexp C<(\w+)> and loop over all matches with C</(\w+)/g>: | |
1362 | ||
1363 | while ($x =~ /(\w+)/g) { | |
1364 | print "Word is $1, ends at position ", pos $x, "\n"; | |
1365 | } | |
1366 | ||
1367 | prints | |
1368 | ||
1369 | Word is cat, ends at position 3 | |
1370 | Word is dog, ends at position 7 | |
1371 | Word is house, ends at position 13 | |
1372 | ||
1373 | A failed match or changing the target string resets the position. If | |
1374 | you don't want the position reset after failure to match, add the | |
1375 | C<//c>, as in C</regexp/gc>. The current position in the string is | |
1376 | associated with the string, not the regexp. This means that different | |
1377 | strings have different positions and their respective positions can be | |
1378 | set or read independently. | |
1379 | ||
1380 | In list context, C<//g> returns a list of matched groupings, or if | |
1381 | there are no groupings, a list of matches to the whole regexp. So if | |
1382 | we wanted just the words, we could use | |
1383 | ||
1384 | @words = ($x =~ /(\w+)/g); # matches, | |
1385 | # $word[0] = 'cat' | |
1386 | # $word[1] = 'dog' | |
1387 | # $word[2] = 'house' | |
1388 | ||
1389 | Closely associated with the C<//g> modifier is the C<\G> anchor. The | |
1390 | C<\G> anchor matches at the point where the previous C<//g> match left | |
1391 | off. C<\G> allows us to easily do context-sensitive matching: | |
1392 | ||
1393 | $metric = 1; # use metric units | |
1394 | ... | |
1395 | $x = <FILE>; # read in measurement | |
1396 | $x =~ /^([+-]?\d+)\s*/g; # get magnitude | |
1397 | $weight = $1; | |
1398 | if ($metric) { # error checking | |
1399 | print "Units error!" unless $x =~ /\Gkg\./g; | |
1400 | } | |
1401 | else { | |
1402 | print "Units error!" unless $x =~ /\Glbs\./g; | |
1403 | } | |
1404 | $x =~ /\G\s+(widget|sprocket)/g; # continue processing | |
1405 | ||
1406 | The combination of C<//g> and C<\G> allows us to process the string a | |
1407 | bit at a time and use arbitrary Perl logic to decide what to do next. | |
25cf8c22 HS |
1408 | Currently, the C<\G> anchor is only fully supported when used to anchor |
1409 | to the start of the pattern. | |
47f9c88b GS |
1410 | |
1411 | C<\G> is also invaluable in processing fixed length records with | |
1412 | regexps. Suppose we have a snippet of coding region DNA, encoded as | |
1413 | base pair letters C<ATCGTTGAAT...> and we want to find all the stop | |
1414 | codons C<TGA>. In a coding region, codons are 3-letter sequences, so | |
1415 | we can think of the DNA snippet as a sequence of 3-letter records. The | |
1416 | naive regexp | |
1417 | ||
1418 | # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC" | |
1419 | $dna = "ATCGTTGAATGCAAATGACATGAC"; | |
1420 | $dna =~ /TGA/; | |
1421 | ||
d1be9408 | 1422 | doesn't work; it may match a C<TGA>, but there is no guarantee that |
47f9c88b GS |
1423 | the match is aligned with codon boundaries, e.g., the substring |
1424 | S<C<GTT GAA> > gives a match. A better solution is | |
1425 | ||
1426 | while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *? | |
1427 | print "Got a TGA stop codon at position ", pos $dna, "\n"; | |
1428 | } | |
1429 | ||
1430 | which prints | |
1431 | ||
1432 | Got a TGA stop codon at position 18 | |
1433 | Got a TGA stop codon at position 23 | |
1434 | ||
1435 | Position 18 is good, but position 23 is bogus. What happened? | |
1436 | ||
1437 | The answer is that our regexp works well until we get past the last | |
1438 | real match. Then the regexp will fail to match a synchronized C<TGA> | |
1439 | and start stepping ahead one character position at a time, not what we | |
1440 | want. The solution is to use C<\G> to anchor the match to the codon | |
1441 | alignment: | |
1442 | ||
1443 | while ($dna =~ /\G(\w\w\w)*?TGA/g) { | |
1444 | print "Got a TGA stop codon at position ", pos $dna, "\n"; | |
1445 | } | |
1446 | ||
1447 | This prints | |
1448 | ||
1449 | Got a TGA stop codon at position 18 | |
1450 | ||
1451 | which is the correct answer. This example illustrates that it is | |
1452 | important not only to match what is desired, but to reject what is not | |
1453 | desired. | |
1454 | ||
1455 | B<search and replace> | |
1456 | ||
1457 | Regular expressions also play a big role in B<search and replace> | |
1458 | operations in Perl. Search and replace is accomplished with the | |
1459 | C<s///> operator. The general form is | |
1460 | C<s/regexp/replacement/modifiers>, with everything we know about | |
1461 | regexps and modifiers applying in this case as well. The | |
1462 | C<replacement> is a Perl double quoted string that replaces in the | |
1463 | string whatever is matched with the C<regexp>. The operator C<=~> is | |
1464 | also used here to associate a string with C<s///>. If matching | |
1465 | against C<$_>, the S<C<$_ =~> > can be dropped. If there is a match, | |
1466 | C<s///> returns the number of substitutions made, otherwise it returns | |
1467 | false. Here are a few examples: | |
1468 | ||
1469 | $x = "Time to feed the cat!"; | |
1470 | $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!" | |
1471 | if ($x =~ s/^(Time.*hacker)!$/$1 now!/) { | |
1472 | $more_insistent = 1; | |
1473 | } | |
1474 | $y = "'quoted words'"; | |
1475 | $y =~ s/^'(.*)'$/$1/; # strip single quotes, | |
1476 | # $y contains "quoted words" | |
1477 | ||
1478 | In the last example, the whole string was matched, but only the part | |
1479 | inside the single quotes was grouped. With the C<s///> operator, the | |
1480 | matched variables C<$1>, C<$2>, etc. are immediately available for use | |
1481 | in the replacement expression, so we use C<$1> to replace the quoted | |
1482 | string with just what was quoted. With the global modifier, C<s///g> | |
1483 | will search and replace all occurrences of the regexp in the string: | |
1484 | ||
1485 | $x = "I batted 4 for 4"; | |
1486 | $x =~ s/4/four/; # doesn't do it all: | |
1487 | # $x contains "I batted four for 4" | |
1488 | $x = "I batted 4 for 4"; | |
1489 | $x =~ s/4/four/g; # does it all: | |
1490 | # $x contains "I batted four for four" | |
1491 | ||
1492 | If you prefer 'regex' over 'regexp' in this tutorial, you could use | |
1493 | the following program to replace it: | |
1494 | ||
1495 | % cat > simple_replace | |
1496 | #!/usr/bin/perl | |
1497 | $regexp = shift; | |
1498 | $replacement = shift; | |
1499 | while (<>) { | |
1500 | s/$regexp/$replacement/go; | |
1501 | print; | |
1502 | } | |
1503 | ^D | |
1504 | ||
1505 | % simple_replace regexp regex perlretut.pod | |
1506 | ||
1507 | In C<simple_replace> we used the C<s///g> modifier to replace all | |
1508 | occurrences of the regexp on each line and the C<s///o> modifier to | |
1509 | compile the regexp only once. As with C<simple_grep>, both the | |
1510 | C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly. | |
1511 | ||
1512 | A modifier available specifically to search and replace is the | |
1513 | C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around | |
1514 | the replacement string and the evaluated result is substituted for the | |
1515 | matched substring. C<s///e> is useful if you need to do a bit of | |
1516 | computation in the process of replacing text. This example counts | |
1517 | character frequencies in a line: | |
1518 | ||
1519 | $x = "Bill the cat"; | |
1520 | $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself | |
1521 | print "frequency of '$_' is $chars{$_}\n" | |
1522 | foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars); | |
1523 | ||
1524 | This prints | |
1525 | ||
1526 | frequency of ' ' is 2 | |
1527 | frequency of 't' is 2 | |
1528 | frequency of 'l' is 2 | |
1529 | frequency of 'B' is 1 | |
1530 | frequency of 'c' is 1 | |
1531 | frequency of 'e' is 1 | |
1532 | frequency of 'h' is 1 | |
1533 | frequency of 'i' is 1 | |
1534 | frequency of 'a' is 1 | |
1535 | ||
1536 | As with the match C<m//> operator, C<s///> can use other delimiters, | |
1537 | such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are | |
1538 | used C<s'''>, then the regexp and replacement are treated as single | |
1539 | quoted strings and there are no substitutions. C<s///> in list context | |
1540 | returns the same thing as in scalar context, i.e., the number of | |
1541 | matches. | |
1542 | ||
1543 | B<The split operator> | |
1544 | ||
1545 | The B<C<split> > function can also optionally use a matching operator | |
1546 | C<m//> to split a string. C<split /regexp/, string, limit> splits | |
1547 | C<string> into a list of substrings and returns that list. The regexp | |
1548 | is used to match the character sequence that the C<string> is split | |
1549 | with respect to. The C<limit>, if present, constrains splitting into | |
1550 | no more than C<limit> number of strings. For example, to split a | |
1551 | string into words, use | |
1552 | ||
1553 | $x = "Calvin and Hobbes"; | |
1554 | @words = split /\s+/, $x; # $word[0] = 'Calvin' | |
1555 | # $word[1] = 'and' | |
1556 | # $word[2] = 'Hobbes' | |
1557 | ||
1558 | If the empty regexp C<//> is used, the regexp always matches and | |
1559 | the string is split into individual characters. If the regexp has | |
1560 | groupings, then list produced contains the matched substrings from the | |
1561 | groupings as well. For instance, | |
1562 | ||
1563 | $x = "/usr/bin/perl"; | |
1564 | @dirs = split m!/!, $x; # $dirs[0] = '' | |
1565 | # $dirs[1] = 'usr' | |
1566 | # $dirs[2] = 'bin' | |
1567 | # $dirs[3] = 'perl' | |
1568 | @parts = split m!(/)!, $x; # $parts[0] = '' | |
1569 | # $parts[1] = '/' | |
1570 | # $parts[2] = 'usr' | |
1571 | # $parts[3] = '/' | |
1572 | # $parts[4] = 'bin' | |
1573 | # $parts[5] = '/' | |
1574 | # $parts[6] = 'perl' | |
1575 | ||
1576 | Since the first character of $x matched the regexp, C<split> prepended | |
1577 | an empty initial element to the list. | |
1578 | ||
1579 | If you have read this far, congratulations! You now have all the basic | |
1580 | tools needed to use regular expressions to solve a wide range of text | |
1581 | processing problems. If this is your first time through the tutorial, | |
1582 | why not stop here and play around with regexps a while... S<Part 2> | |
1583 | concerns the more esoteric aspects of regular expressions and those | |
1584 | concepts certainly aren't needed right at the start. | |
1585 | ||
1586 | =head1 Part 2: Power tools | |
1587 | ||
1588 | OK, you know the basics of regexps and you want to know more. If | |
1589 | matching regular expressions is analogous to a walk in the woods, then | |
1590 | the tools discussed in Part 1 are analogous to topo maps and a | |
1591 | compass, basic tools we use all the time. Most of the tools in part 2 | |
da75cd15 | 1592 | are analogous to flare guns and satellite phones. They aren't used |
47f9c88b GS |
1593 | too often on a hike, but when we are stuck, they can be invaluable. |
1594 | ||
1595 | What follows are the more advanced, less used, or sometimes esoteric | |
1596 | capabilities of perl regexps. In Part 2, we will assume you are | |
1597 | comfortable with the basics and concentrate on the new features. | |
1598 | ||
1599 | =head2 More on characters, strings, and character classes | |
1600 | ||
1601 | There are a number of escape sequences and character classes that we | |
1602 | haven't covered yet. | |
1603 | ||
1604 | There are several escape sequences that convert characters or strings | |
1605 | between upper and lower case. C<\l> and C<\u> convert the next | |
1606 | character to lower or upper case, respectively: | |
1607 | ||
1608 | $x = "perl"; | |
1609 | $string =~ /\u$x/; # matches 'Perl' in $string | |
1610 | $x = "M(rs?|s)\\."; # note the double backslash | |
1611 | $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.', | |
1612 | ||
1613 | C<\L> and C<\U> converts a whole substring, delimited by C<\L> or | |
1614 | C<\U> and C<\E>, to lower or upper case: | |
1615 | ||
1616 | $x = "This word is in lower case:\L SHOUT\E"; | |
1617 | $x =~ /shout/; # matches | |
1618 | $x = "I STILL KEYPUNCH CARDS FOR MY 360" | |
1619 | $x =~ /\Ukeypunch/; # matches punch card string | |
1620 | ||
1621 | If there is no C<\E>, case is converted until the end of the | |
1622 | string. The regexps C<\L\u$word> or C<\u\L$word> convert the first | |
1623 | character of C<$word> to uppercase and the rest of the characters to | |
1624 | lowercase. | |
1625 | ||
1626 | Control characters can be escaped with C<\c>, so that a control-Z | |
1627 | character would be matched with C<\cZ>. The escape sequence | |
1628 | C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For | |
1629 | instance, | |
1630 | ||
1631 | $x = "\QThat !^*&%~& cat!"; | |
1632 | $x =~ /\Q!^*&%~&\E/; # check for rough language | |
1633 | ||
1634 | It does not protect C<$> or C<@>, so that variables can still be | |
1635 | substituted. | |
1636 | ||
1637 | With the advent of 5.6.0, perl regexps can handle more than just the | |
1638 | standard ASCII character set. Perl now supports B<Unicode>, a standard | |
1639 | for encoding the character sets from many of the world's written | |
1640 | languages. Unicode does this by allowing characters to be more than | |
1641 | one byte wide. Perl uses the UTF-8 encoding, in which ASCII characters | |
1642 | are still encoded as one byte, but characters greater than C<chr(127)> | |
1643 | may be stored as two or more bytes. | |
1644 | ||
1645 | What does this mean for regexps? Well, regexp users don't need to know | |
1646 | much about perl's internal representation of strings. But they do need | |
1647 | to know 1) how to represent Unicode characters in a regexp and 2) when | |
1648 | a matching operation will treat the string to be searched as a | |
1649 | sequence of bytes (the old way) or as a sequence of Unicode characters | |
1650 | (the new way). The answer to 1) is that Unicode characters greater | |
1651 | than C<chr(127)> may be represented using the C<\x{hex}> notation, | |
1652 | with C<hex> a hexadecimal integer: | |
1653 | ||
47f9c88b GS |
1654 | /\x{263a}/; # match a Unicode smiley face :) |
1655 | ||
1656 | Unicode characters in the range of 128-255 use two hexadecimal digits | |
1657 | with braces: C<\x{ab}>. Note that this is different than C<\xab>, | |
ad0029c4 JH |
1658 | which is just a hexadecimal byte with no Unicode significance. |
1659 | ||
72ff2908 JH |
1660 | B<NOTE>: in Perl 5.6.0 it used to be that one needed to say C<use |
1661 | utf8> to use any Unicode features. This is no more the case: for | |
1662 | almost all Unicode processing, the explicit C<utf8> pragma is not | |
1663 | needed. (The only case where it matters is if your Perl script is in | |
1664 | Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.) | |
47f9c88b GS |
1665 | |
1666 | Figuring out the hexadecimal sequence of a Unicode character you want | |
1667 | or deciphering someone else's hexadecimal Unicode regexp is about as | |
1668 | much fun as programming in machine code. So another way to specify | |
1669 | Unicode characters is to use the S<B<named character> > escape | |
1670 | sequence C<\N{name}>. C<name> is a name for the Unicode character, as | |
55eda711 JH |
1671 | specified in the Unicode standard. For instance, if we wanted to |
1672 | represent or match the astrological sign for the planet Mercury, we | |
1673 | could use | |
47f9c88b | 1674 | |
47f9c88b GS |
1675 | use charnames ":full"; # use named chars with Unicode full names |
1676 | $x = "abc\N{MERCURY}def"; | |
1677 | $x =~ /\N{MERCURY}/; # matches | |
1678 | ||
1679 | One can also use short names or restrict names to a certain alphabet: | |
1680 | ||
47f9c88b GS |
1681 | use charnames ':full'; |
1682 | print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n"; | |
1683 | ||
1684 | use charnames ":short"; | |
1685 | print "\N{greek:Sigma} is an upper-case sigma.\n"; | |
1686 | ||
1687 | use charnames qw(greek); | |
1688 | print "\N{sigma} is Greek sigma\n"; | |
1689 | ||
1690 | A list of full names is found in the file Names.txt in the | |
55d7b906 | 1691 | lib/perl5/5.X.X/unicore directory. |
47f9c88b GS |
1692 | |
1693 | The answer to requirement 2), as of 5.6.0, is that if a regexp | |
1694 | contains Unicode characters, the string is searched as a sequence of | |
1695 | Unicode characters. Otherwise, the string is searched as a sequence of | |
1696 | bytes. If the string is being searched as a sequence of Unicode | |
1697 | characters, but matching a single byte is required, we can use the C<\C> | |
1698 | escape sequence. C<\C> is a character class akin to C<.> except that | |
1699 | it matches I<any> byte 0-255. So | |
1700 | ||
47f9c88b GS |
1701 | use charnames ":full"; # use named chars with Unicode full names |
1702 | $x = "a"; | |
1703 | $x =~ /\C/; # matches 'a', eats one byte | |
1704 | $x = ""; | |
1705 | $x =~ /\C/; # doesn't match, no bytes to match | |
1706 | $x = "\N{MERCURY}"; # two-byte Unicode character | |
1707 | $x =~ /\C/; # matches, but dangerous! | |
1708 | ||
1709 | The last regexp matches, but is dangerous because the string | |
a6b2f353 | 1710 | I<character> position is no longer synchronized to the string I<byte> |
47f9c88b | 1711 | position. This generates the warning 'Malformed UTF-8 |
f14c76ed | 1712 | character'. The C<\C> is best used for matching the binary data in strings |
47f9c88b GS |
1713 | with binary data intermixed with Unicode characters. |
1714 | ||
1715 | Let us now discuss the rest of the character classes. Just as with | |
1716 | Unicode characters, there are named Unicode character classes | |
1717 | represented by the C<\p{name}> escape sequence. Closely associated is | |
1718 | the C<\P{name}> character class, which is the negation of the | |
1719 | C<\p{name}> class. For example, to match lower and uppercase | |
1720 | characters, | |
1721 | ||
47f9c88b GS |
1722 | use charnames ":full"; # use named chars with Unicode full names |
1723 | $x = "BOB"; | |
1724 | $x =~ /^\p{IsUpper}/; # matches, uppercase char class | |
1725 | $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase | |
1726 | $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class | |
1727 | $x =~ /^\P{IsLower}/; # matches, char class sans lowercase | |
1728 | ||
86929931 JH |
1729 | Here is the association between some Perl named classes and the |
1730 | traditional Unicode classes: | |
47f9c88b | 1731 | |
86929931 | 1732 | Perl class name Unicode class name or regular expression |
47f9c88b | 1733 | |
f5868911 JH |
1734 | IsAlpha /^[LM]/ |
1735 | IsAlnum /^[LMN]/ | |
1736 | IsASCII $code <= 127 | |
1737 | IsCntrl /^C/ | |
1738 | IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/ | |
47f9c88b | 1739 | IsDigit Nd |
f5868911 | 1740 | IsGraph /^([LMNPS]|Co)/ |
47f9c88b | 1741 | IsLower Ll |
f5868911 JH |
1742 | IsPrint /^([LMNPS]|Co|Zs)/ |
1743 | IsPunct /^P/ | |
1744 | IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/ | |
08ce8fc6 | 1745 | IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/ |
f5868911 JH |
1746 | IsUpper /^L[ut]/ |
1747 | IsWord /^[LMN]/ || $code eq "005F" | |
47f9c88b GS |
1748 | IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/ |
1749 | ||
86929931 JH |
1750 | You can also use the official Unicode class names with the C<\p> and |
1751 | C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase | |
1752 | letters, or C<\P{Nd}> for non-digits. If a C<name> is just one | |
1753 | letter, the braces can be dropped. For instance, C<\pM> is the | |
98f22ffc | 1754 | character class of Unicode 'marks', for example accent marks. |
32293815 JH |
1755 | For the full list see L<perlunicode>. |
1756 | ||
fa11829f | 1757 | The Unicode has also been separated into various sets of characters |
5e42d7b4 | 1758 | which you can test with C<\p{In...}> (in) and C<\P{In...}> (not in), |
1d81abf3 | 1759 | for example C<\p{Latin}>, C<\p{Greek}>, or C<\P{Katakana}>. |
5e42d7b4 | 1760 | For the full list see L<perlunicode>. |
47f9c88b GS |
1761 | |
1762 | C<\X> is an abbreviation for a character class sequence that includes | |
1763 | the Unicode 'combining character sequences'. A 'combining character | |
1764 | sequence' is a base character followed by any number of combining | |
1765 | characters. An example of a combining character is an accent. Using | |
1766 | the Unicode full names, e.g., S<C<A + COMBINING RING> > is a combining | |
1767 | character sequence with base character C<A> and combining character | |
1768 | S<C<COMBINING RING> >, which translates in Danish to A with the circle | |
1769 | atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>, | |
1770 | i.e., a non-mark followed by one or more marks. | |
1771 | ||
da75cd15 | 1772 | For the full and latest information about Unicode see the latest |
5e42d7b4 JH |
1773 | Unicode standard, or the Unicode Consortium's website http://www.unicode.org/ |
1774 | ||
47f9c88b GS |
1775 | As if all those classes weren't enough, Perl also defines POSIX style |
1776 | character classes. These have the form C<[:name:]>, with C<name> the | |
aaa51d5e JF |
1777 | name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>, |
1778 | C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>, | |
1779 | C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl | |
1780 | extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8> | |
1781 | is being used, then these classes are defined the same as their | |
1782 | corresponding perl Unicode classes: C<[:upper:]> is the same as | |
1783 | C<\p{IsUpper}>, etc. The POSIX character classes, however, don't | |
1784 | require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and | |
47f9c88b | 1785 | C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s> |
aaa51d5e JF |
1786 | character classes. To negate a POSIX class, put a C<^> in front of |
1787 | the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under | |
47f9c88b | 1788 | C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can |
54c18d04 MK |
1789 | be used just like C<\d>, with the exception that POSIX character |
1790 | classes can only be used inside of a character class: | |
47f9c88b GS |
1791 | |
1792 | /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit | |
54c18d04 | 1793 | /^=item\s[[:digit:]]/; # match '=item', |
47f9c88b | 1794 | # followed by a space and a digit |
47f9c88b GS |
1795 | use charnames ":full"; |
1796 | /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit | |
1797 | /^=item\s\p{IsDigit}/; # match '=item', | |
1798 | # followed by a space and a digit | |
1799 | ||
1800 | Whew! That is all the rest of the characters and character classes. | |
1801 | ||
1802 | =head2 Compiling and saving regular expressions | |
1803 | ||
1804 | In Part 1 we discussed the C<//o> modifier, which compiles a regexp | |
1805 | just once. This suggests that a compiled regexp is some data structure | |
1806 | that can be stored once and used again and again. The regexp quote | |
1807 | C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a | |
1808 | regexp and transforms the result into a form that can be assigned to a | |
1809 | variable: | |
1810 | ||
1811 | $reg = qr/foo+bar?/; # reg contains a compiled regexp | |
1812 | ||
1813 | Then C<$reg> can be used as a regexp: | |
1814 | ||
1815 | $x = "fooooba"; | |
1816 | $x =~ $reg; # matches, just like /foo+bar?/ | |
1817 | $x =~ /$reg/; # same thing, alternate form | |
1818 | ||
1819 | C<$reg> can also be interpolated into a larger regexp: | |
1820 | ||
1821 | $x =~ /(abc)?$reg/; # still matches | |
1822 | ||
1823 | As with the matching operator, the regexp quote can use different | |
1824 | delimiters, e.g., C<qr!!>, C<qr{}> and C<qr~~>. The single quote | |
1825 | delimiters C<qr''> prevent any interpolation from taking place. | |
1826 | ||
1827 | Pre-compiled regexps are useful for creating dynamic matches that | |
1828 | don't need to be recompiled each time they are encountered. Using | |
1829 | pre-compiled regexps, C<simple_grep> program can be expanded into a | |
1830 | program that matches multiple patterns: | |
1831 | ||
1832 | % cat > multi_grep | |
1833 | #!/usr/bin/perl | |
1834 | # multi_grep - match any of <number> regexps | |
1835 | # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ... | |
1836 | ||
1837 | $number = shift; | |
1838 | $regexp[$_] = shift foreach (0..$number-1); | |
1839 | @compiled = map qr/$_/, @regexp; | |
1840 | while ($line = <>) { | |
1841 | foreach $pattern (@compiled) { | |
1842 | if ($line =~ /$pattern/) { | |
1843 | print $line; | |
1844 | last; # we matched, so move onto the next line | |
1845 | } | |
1846 | } | |
1847 | } | |
1848 | ^D | |
1849 | ||
1850 | % multi_grep 2 last for multi_grep | |
1851 | $regexp[$_] = shift foreach (0..$number-1); | |
1852 | foreach $pattern (@compiled) { | |
1853 | last; | |
1854 | ||
1855 | Storing pre-compiled regexps in an array C<@compiled> allows us to | |
1856 | simply loop through the regexps without any recompilation, thus gaining | |
1857 | flexibility without sacrificing speed. | |
1858 | ||
1859 | =head2 Embedding comments and modifiers in a regular expression | |
1860 | ||
1861 | Starting with this section, we will be discussing Perl's set of | |
1862 | B<extended patterns>. These are extensions to the traditional regular | |
1863 | expression syntax that provide powerful new tools for pattern | |
1864 | matching. We have already seen extensions in the form of the minimal | |
1865 | matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The | |
1866 | rest of the extensions below have the form C<(?char...)>, where the | |
1867 | C<char> is a character that determines the type of extension. | |
1868 | ||
1869 | The first extension is an embedded comment C<(?#text)>. This embeds a | |
1870 | comment into the regular expression without affecting its meaning. The | |
1871 | comment should not have any closing parentheses in the text. An | |
1872 | example is | |
1873 | ||
1874 | /(?# Match an integer:)[+-]?\d+/; | |
1875 | ||
1876 | This style of commenting has been largely superseded by the raw, | |
1877 | freeform commenting that is allowed with the C<//x> modifier. | |
1878 | ||
1879 | The modifiers C<//i>, C<//m>, C<//s>, and C<//x> can also embedded in | |
1880 | a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance, | |
1881 | ||
1882 | /(?i)yes/; # match 'yes' case insensitively | |
1883 | /yes/i; # same thing | |
1884 | /(?x)( # freeform version of an integer regexp | |
1885 | [+-]? # match an optional sign | |
1886 | \d+ # match a sequence of digits | |
1887 | ) | |
1888 | /x; | |
1889 | ||
1890 | Embedded modifiers can have two important advantages over the usual | |
1891 | modifiers. Embedded modifiers allow a custom set of modifiers to | |
1892 | I<each> regexp pattern. This is great for matching an array of regexps | |
1893 | that must have different modifiers: | |
1894 | ||
1895 | $pattern[0] = '(?i)doctor'; | |
1896 | $pattern[1] = 'Johnson'; | |
1897 | ... | |
1898 | while (<>) { | |
1899 | foreach $patt (@pattern) { | |
1900 | print if /$patt/; | |
1901 | } | |
1902 | } | |
1903 | ||
1904 | The second advantage is that embedded modifiers only affect the regexp | |
1905 | inside the group the embedded modifier is contained in. So grouping | |
1906 | can be used to localize the modifier's effects: | |
1907 | ||
1908 | /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc. | |
1909 | ||
1910 | Embedded modifiers can also turn off any modifiers already present | |
1911 | by using, e.g., C<(?-i)>. Modifiers can also be combined into | |
1912 | a single expression, e.g., C<(?s-i)> turns on single line mode and | |
1913 | turns off case insensitivity. | |
1914 | ||
1915 | =head2 Non-capturing groupings | |
1916 | ||
1917 | We noted in Part 1 that groupings C<()> had two distinct functions: 1) | |
1918 | group regexp elements together as a single unit, and 2) extract, or | |
1919 | capture, substrings that matched the regexp in the | |
1920 | grouping. Non-capturing groupings, denoted by C<(?:regexp)>, allow the | |
1921 | regexp to be treated as a single unit, but don't extract substrings or | |
1922 | set matching variables C<$1>, etc. Both capturing and non-capturing | |
1923 | groupings are allowed to co-exist in the same regexp. Because there is | |
1924 | no extraction, non-capturing groupings are faster than capturing | |
1925 | groupings. Non-capturing groupings are also handy for choosing exactly | |
1926 | which parts of a regexp are to be extracted to matching variables: | |
1927 | ||
1928 | # match a number, $1-$4 are set, but we only want $1 | |
1929 | /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/; | |
1930 | ||
1931 | # match a number faster , only $1 is set | |
1932 | /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/; | |
1933 | ||
1934 | # match a number, get $1 = whole number, $2 = exponent | |
1935 | /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/; | |
1936 | ||
1937 | Non-capturing groupings are also useful for removing nuisance | |
1938 | elements gathered from a split operation: | |
1939 | ||
1940 | $x = '12a34b5'; | |
1941 | @num = split /(a|b)/, $x; # @num = ('12','a','34','b','5') | |
1942 | @num = split /(?:a|b)/, $x; # @num = ('12','34','5') | |
1943 | ||
1944 | Non-capturing groupings may also have embedded modifiers: | |
1945 | C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp> | |
1946 | case insensitively and turns off multi-line mode. | |
1947 | ||
1948 | =head2 Looking ahead and looking behind | |
1949 | ||
1950 | This section concerns the lookahead and lookbehind assertions. First, | |
1951 | a little background. | |
1952 | ||
1953 | In Perl regular expressions, most regexp elements 'eat up' a certain | |
1954 | amount of string when they match. For instance, the regexp element | |
1955 | C<[abc}]> eats up one character of the string when it matches, in the | |
1956 | sense that perl moves to the next character position in the string | |
1957 | after the match. There are some elements, however, that don't eat up | |
1958 | characters (advance the character position) if they match. The examples | |
1959 | we have seen so far are the anchors. The anchor C<^> matches the | |
1960 | beginning of the line, but doesn't eat any characters. Similarly, the | |
1961 | word boundary anchor C<\b> matches, e.g., if the character to the left | |
1962 | is a word character and the character to the right is a non-word | |
1963 | character, but it doesn't eat up any characters itself. Anchors are | |
1964 | examples of 'zero-width assertions'. Zero-width, because they consume | |
1965 | no characters, and assertions, because they test some property of the | |
1966 | string. In the context of our walk in the woods analogy to regexp | |
1967 | matching, most regexp elements move us along a trail, but anchors have | |
1968 | us stop a moment and check our surroundings. If the local environment | |
1969 | checks out, we can proceed forward. But if the local environment | |
1970 | doesn't satisfy us, we must backtrack. | |
1971 | ||
1972 | Checking the environment entails either looking ahead on the trail, | |
1973 | looking behind, or both. C<^> looks behind, to see that there are no | |
1974 | characters before. C<$> looks ahead, to see that there are no | |
1975 | characters after. C<\b> looks both ahead and behind, to see if the | |
1976 | characters on either side differ in their 'word'-ness. | |
1977 | ||
1978 | The lookahead and lookbehind assertions are generalizations of the | |
1979 | anchor concept. Lookahead and lookbehind are zero-width assertions | |
1980 | that let us specify which characters we want to test for. The | |
1981 | lookahead assertion is denoted by C<(?=regexp)> and the lookbehind | |
a6b2f353 | 1982 | assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are |
47f9c88b GS |
1983 | |
1984 | $x = "I catch the housecat 'Tom-cat' with catnip"; | |
1985 | $x =~ /cat(?=\s+)/; # matches 'cat' in 'housecat' | |
1986 | @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches, | |
1987 | # $catwords[0] = 'catch' | |
1988 | # $catwords[1] = 'catnip' | |
1989 | $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat' | |
1990 | $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in | |
1991 | # middle of $x | |
1992 | ||
a6b2f353 | 1993 | Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are |
47f9c88b GS |
1994 | non-capturing, since these are zero-width assertions. Thus in the |
1995 | second regexp, the substrings captured are those of the whole regexp | |
a6b2f353 GS |
1996 | itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but |
1997 | lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed | |
1998 | width, i.e., a fixed number of characters long. Thus | |
1999 | C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The | |
2000 | negated versions of the lookahead and lookbehind assertions are | |
2001 | denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively. | |
2002 | They evaluate true if the regexps do I<not> match: | |
47f9c88b GS |
2003 | |
2004 | $x = "foobar"; | |
2005 | $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo' | |
2006 | $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo' | |
2007 | $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo' | |
2008 | ||
f14c76ed RGS |
2009 | The C<\C> is unsupported in lookbehind, because the already |
2010 | treacherous definition of C<\C> would become even more so | |
2011 | when going backwards. | |
2012 | ||
47f9c88b GS |
2013 | =head2 Using independent subexpressions to prevent backtracking |
2014 | ||
2015 | The last few extended patterns in this tutorial are experimental as of | |
2016 | 5.6.0. Play with them, use them in some code, but don't rely on them | |
2017 | just yet for production code. | |
2018 | ||
2019 | S<B<Independent subexpressions> > are regular expressions, in the | |
2020 | context of a larger regular expression, that function independently of | |
2021 | the larger regular expression. That is, they consume as much or as | |
2022 | little of the string as they wish without regard for the ability of | |
2023 | the larger regexp to match. Independent subexpressions are represented | |
2024 | by C<< (?>regexp) >>. We can illustrate their behavior by first | |
2025 | considering an ordinary regexp: | |
2026 | ||
2027 | $x = "ab"; | |
2028 | $x =~ /a*ab/; # matches | |
2029 | ||
2030 | This obviously matches, but in the process of matching, the | |
2031 | subexpression C<a*> first grabbed the C<a>. Doing so, however, | |
2032 | wouldn't allow the whole regexp to match, so after backtracking, C<a*> | |
2033 | eventually gave back the C<a> and matched the empty string. Here, what | |
2034 | C<a*> matched was I<dependent> on what the rest of the regexp matched. | |
2035 | ||
2036 | Contrast that with an independent subexpression: | |
2037 | ||
2038 | $x =~ /(?>a*)ab/; # doesn't match! | |
2039 | ||
2040 | The independent subexpression C<< (?>a*) >> doesn't care about the rest | |
2041 | of the regexp, so it sees an C<a> and grabs it. Then the rest of the | |
2042 | regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there | |
da75cd15 | 2043 | is no backtracking and the independent subexpression does not give |
47f9c88b GS |
2044 | up its C<a>. Thus the match of the regexp as a whole fails. A similar |
2045 | behavior occurs with completely independent regexps: | |
2046 | ||
2047 | $x = "ab"; | |
2048 | $x =~ /a*/g; # matches, eats an 'a' | |
2049 | $x =~ /\Gab/g; # doesn't match, no 'a' available | |
2050 | ||
2051 | Here C<//g> and C<\G> create a 'tag team' handoff of the string from | |
2052 | one regexp to the other. Regexps with an independent subexpression are | |
2053 | much like this, with a handoff of the string to the independent | |
2054 | subexpression, and a handoff of the string back to the enclosing | |
2055 | regexp. | |
2056 | ||
2057 | The ability of an independent subexpression to prevent backtracking | |
2058 | can be quite useful. Suppose we want to match a non-empty string | |
2059 | enclosed in parentheses up to two levels deep. Then the following | |
2060 | regexp matches: | |
2061 | ||
2062 | $x = "abc(de(fg)h"; # unbalanced parentheses | |
2063 | $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x; | |
2064 | ||
2065 | The regexp matches an open parenthesis, one or more copies of an | |
2066 | alternation, and a close parenthesis. The alternation is two-way, with | |
2067 | the first alternative C<[^()]+> matching a substring with no | |
2068 | parentheses and the second alternative C<\([^()]*\)> matching a | |
2069 | substring delimited by parentheses. The problem with this regexp is | |
2070 | that it is pathological: it has nested indeterminate quantifiers | |
07698885 | 2071 | of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers |
47f9c88b GS |
2072 | like this could take an exponentially long time to execute if there |
2073 | was no match possible. To prevent the exponential blowup, we need to | |
2074 | prevent useless backtracking at some point. This can be done by | |
2075 | enclosing the inner quantifier as an independent subexpression: | |
2076 | ||
2077 | $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x; | |
2078 | ||
2079 | Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning | |
2080 | by gobbling up as much of the string as possible and keeping it. Then | |
2081 | match failures fail much more quickly. | |
2082 | ||
2083 | =head2 Conditional expressions | |
2084 | ||
2085 | A S<B<conditional expression> > is a form of if-then-else statement | |
2086 | that allows one to choose which patterns are to be matched, based on | |
2087 | some condition. There are two types of conditional expression: | |
2088 | C<(?(condition)yes-regexp)> and | |
2089 | C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is | |
2090 | like an S<C<'if () {}'> > statement in Perl. If the C<condition> is true, | |
2091 | the C<yes-regexp> will be matched. If the C<condition> is false, the | |
2092 | C<yes-regexp> will be skipped and perl will move onto the next regexp | |
2093 | element. The second form is like an S<C<'if () {} else {}'> > statement | |
2094 | in Perl. If the C<condition> is true, the C<yes-regexp> will be | |
2095 | matched, otherwise the C<no-regexp> will be matched. | |
2096 | ||
2097 | The C<condition> can have two forms. The first form is simply an | |
2098 | integer in parentheses C<(integer)>. It is true if the corresponding | |
2099 | backreference C<\integer> matched earlier in the regexp. The second | |
2100 | form is a bare zero width assertion C<(?...)>, either a | |
2101 | lookahead, a lookbehind, or a code assertion (discussed in the next | |
2102 | section). | |
2103 | ||
2104 | The integer form of the C<condition> allows us to choose, with more | |
2105 | flexibility, what to match based on what matched earlier in the | |
2106 | regexp. This searches for words of the form C<"$x$x"> or | |
2107 | C<"$x$y$y$x">: | |
2108 | ||
2109 | % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words | |
2110 | beriberi | |
2111 | coco | |
2112 | couscous | |
2113 | deed | |
2114 | ... | |
2115 | toot | |
2116 | toto | |
2117 | tutu | |
2118 | ||
2119 | The lookbehind C<condition> allows, along with backreferences, | |
2120 | an earlier part of the match to influence a later part of the | |
2121 | match. For instance, | |
2122 | ||
2123 | /[ATGC]+(?(?<=AA)G|C)$/; | |
2124 | ||
2125 | matches a DNA sequence such that it either ends in C<AAG>, or some | |
2126 | other base pair combination and C<C>. Note that the form is | |
a6b2f353 GS |
2127 | C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the |
2128 | lookahead, lookbehind or code assertions, the parentheses around the | |
2129 | conditional are not needed. | |
47f9c88b GS |
2130 | |
2131 | =head2 A bit of magic: executing Perl code in a regular expression | |
2132 | ||
2133 | Normally, regexps are a part of Perl expressions. | |
2134 | S<B<Code evaluation> > expressions turn that around by allowing | |
da75cd15 | 2135 | arbitrary Perl code to be a part of a regexp. A code evaluation |
47f9c88b GS |
2136 | expression is denoted C<(?{code})>, with C<code> a string of Perl |
2137 | statements. | |
2138 | ||
2139 | Code expressions are zero-width assertions, and the value they return | |
2140 | depends on their environment. There are two possibilities: either the | |
2141 | code expression is used as a conditional in a conditional expression | |
2142 | C<(?(condition)...)>, or it is not. If the code expression is a | |
2143 | conditional, the code is evaluated and the result (i.e., the result of | |
2144 | the last statement) is used to determine truth or falsehood. If the | |
2145 | code expression is not used as a conditional, the assertion always | |
2146 | evaluates true and the result is put into the special variable | |
2147 | C<$^R>. The variable C<$^R> can then be used in code expressions later | |
2148 | in the regexp. Here are some silly examples: | |
2149 | ||
2150 | $x = "abcdef"; | |
2151 | $x =~ /abc(?{print "Hi Mom!";})def/; # matches, | |
2152 | # prints 'Hi Mom!' | |
2153 | $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match, | |
2154 | # no 'Hi Mom!' | |
745e1e41 DC |
2155 | |
2156 | Pay careful attention to the next example: | |
2157 | ||
47f9c88b GS |
2158 | $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match, |
2159 | # no 'Hi Mom!' | |
745e1e41 DC |
2160 | # but why not? |
2161 | ||
2162 | At first glance, you'd think that it shouldn't print, because obviously | |
2163 | the C<ddd> isn't going to match the target string. But look at this | |
2164 | example: | |
2165 | ||
2166 | $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match, | |
2167 | # but _does_ print | |
2168 | ||
2169 | Hmm. What happened here? If you've been following along, you know that | |
2170 | the above pattern should be effectively the same as the last one -- | |
2171 | enclosing the d in a character class isn't going to change what it | |
2172 | matches. So why does the first not print while the second one does? | |
2173 | ||
2174 | The answer lies in the optimizations the REx engine makes. In the first | |
2175 | case, all the engine sees are plain old characters (aside from the | |
2176 | C<?{}> construct). It's smart enough to realize that the string 'ddd' | |
2177 | doesn't occur in our target string before actually running the pattern | |
2178 | through. But in the second case, we've tricked it into thinking that our | |
2179 | pattern is more complicated than it is. It takes a look, sees our | |
2180 | character class, and decides that it will have to actually run the | |
2181 | pattern to determine whether or not it matches, and in the process of | |
2182 | running it hits the print statement before it discovers that we don't | |
2183 | have a match. | |
2184 | ||
2185 | To take a closer look at how the engine does optimizations, see the | |
2186 | section L<"Pragmas and debugging"> below. | |
2187 | ||
2188 | More fun with C<?{}>: | |
2189 | ||
47f9c88b GS |
2190 | $x =~ /(?{print "Hi Mom!";})/; # matches, |
2191 | # prints 'Hi Mom!' | |
2192 | $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches, | |
2193 | # prints '1' | |
2194 | $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches, | |
2195 | # prints '1' | |
2196 | ||
2197 | The bit of magic mentioned in the section title occurs when the regexp | |
2198 | backtracks in the process of searching for a match. If the regexp | |
2199 | backtracks over a code expression and if the variables used within are | |
2200 | localized using C<local>, the changes in the variables produced by the | |
2201 | code expression are undone! Thus, if we wanted to count how many times | |
2202 | a character got matched inside a group, we could use, e.g., | |
2203 | ||
2204 | $x = "aaaa"; | |
2205 | $count = 0; # initialize 'a' count | |
2206 | $c = "bob"; # test if $c gets clobbered | |
2207 | $x =~ /(?{local $c = 0;}) # initialize count | |
2208 | ( a # match 'a' | |
2209 | (?{local $c = $c + 1;}) # increment count | |
2210 | )* # do this any number of times, | |
2211 | aa # but match 'aa' at the end | |
2212 | (?{$count = $c;}) # copy local $c var into $count | |
2213 | /x; | |
2214 | print "'a' count is $count, \$c variable is '$c'\n"; | |
2215 | ||
2216 | This prints | |
2217 | ||
2218 | 'a' count is 2, $c variable is 'bob' | |
2219 | ||
2220 | If we replace the S<C< (?{local $c = $c + 1;})> > with | |
2221 | S<C< (?{$c = $c + 1;})> >, the variable changes are I<not> undone | |
2222 | during backtracking, and we get | |
2223 | ||
2224 | 'a' count is 4, $c variable is 'bob' | |
2225 | ||
2226 | Note that only localized variable changes are undone. Other side | |
2227 | effects of code expression execution are permanent. Thus | |
2228 | ||
2229 | $x = "aaaa"; | |
2230 | $x =~ /(a(?{print "Yow\n";}))*aa/; | |
2231 | ||
2232 | produces | |
2233 | ||
2234 | Yow | |
2235 | Yow | |
2236 | Yow | |
2237 | Yow | |
2238 | ||
2239 | The result C<$^R> is automatically localized, so that it will behave | |
2240 | properly in the presence of backtracking. | |
2241 | ||
2242 | This example uses a code expression in a conditional to match the | |
2243 | article 'the' in either English or German: | |
2244 | ||
47f9c88b GS |
2245 | $lang = 'DE'; # use German |
2246 | ... | |
2247 | $text = "das"; | |
2248 | print "matched\n" | |
2249 | if $text =~ /(?(?{ | |
2250 | $lang eq 'EN'; # is the language English? | |
2251 | }) | |
2252 | the | # if so, then match 'the' | |
2253 | (die|das|der) # else, match 'die|das|der' | |
2254 | ) | |
2255 | /xi; | |
2256 | ||
2257 | Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not | |
2258 | C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a | |
2259 | code expression, we don't need the extra parentheses around the | |
2260 | conditional. | |
2261 | ||
a6b2f353 GS |
2262 | If you try to use code expressions with interpolating variables, perl |
2263 | may surprise you: | |
2264 | ||
2265 | $bar = 5; | |
2266 | $pat = '(?{ 1 })'; | |
2267 | /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated | |
2268 | /foo(?{ 1 })$bar/; # compile error! | |
2269 | /foo${pat}bar/; # compile error! | |
2270 | ||
2271 | $pat = qr/(?{ $foo = 1 })/; # precompile code regexp | |
2272 | /foo${pat}bar/; # compiles ok | |
2273 | ||
fa11829f | 2274 | If a regexp has (1) code expressions and interpolating variables, or |
a6b2f353 GS |
2275 | (2) a variable that interpolates a code expression, perl treats the |
2276 | regexp as an error. If the code expression is precompiled into a | |
2277 | variable, however, interpolating is ok. The question is, why is this | |
2278 | an error? | |
2279 | ||
2280 | The reason is that variable interpolation and code expressions | |
2281 | together pose a security risk. The combination is dangerous because | |
2282 | many programmers who write search engines often take user input and | |
2283 | plug it directly into a regexp: | |
47f9c88b GS |
2284 | |
2285 | $regexp = <>; # read user-supplied regexp | |
2286 | $chomp $regexp; # get rid of possible newline | |
2287 | $text =~ /$regexp/; # search $text for the $regexp | |
2288 | ||
a6b2f353 GS |
2289 | If the C<$regexp> variable contains a code expression, the user could |
2290 | then execute arbitrary Perl code. For instance, some joker could | |
47f9c88b GS |
2291 | search for S<C<system('rm -rf *');> > to erase your files. In this |
2292 | sense, the combination of interpolation and code expressions B<taints> | |
2293 | your regexp. So by default, using both interpolation and code | |
a6b2f353 GS |
2294 | expressions in the same regexp is not allowed. If you're not |
2295 | concerned about malicious users, it is possible to bypass this | |
2296 | security check by invoking S<C<use re 'eval'> >: | |
2297 | ||
2298 | use re 'eval'; # throw caution out the door | |
2299 | $bar = 5; | |
2300 | $pat = '(?{ 1 })'; | |
2301 | /foo(?{ 1 })$bar/; # compiles ok | |
2302 | /foo${pat}bar/; # compiles ok | |
47f9c88b GS |
2303 | |
2304 | Another form of code expression is the S<B<pattern code expression> >. | |
2305 | The pattern code expression is like a regular code expression, except | |
2306 | that the result of the code evaluation is treated as a regular | |
2307 | expression and matched immediately. A simple example is | |
2308 | ||
2309 | $length = 5; | |
2310 | $char = 'a'; | |
2311 | $x = 'aaaaabb'; | |
2312 | $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a' | |
2313 | ||
2314 | ||
2315 | This final example contains both ordinary and pattern code | |
2316 | expressions. It detects if a binary string C<1101010010001...> has a | |
2317 | Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s: | |
2318 | ||
47f9c88b GS |
2319 | $s0 = 0; $s1 = 1; # initial conditions |
2320 | $x = "1101010010001000001"; | |
2321 | print "It is a Fibonacci sequence\n" | |
2322 | if $x =~ /^1 # match an initial '1' | |
2323 | ( | |
2324 | (??{'0' x $s0}) # match $s0 of '0' | |
2325 | 1 # and then a '1' | |
2326 | (?{ | |
2327 | $largest = $s0; # largest seq so far | |
2328 | $s2 = $s1 + $s0; # compute next term | |
2329 | $s0 = $s1; # in Fibonacci sequence | |
2330 | $s1 = $s2; | |
2331 | }) | |
2332 | )+ # repeat as needed | |
2333 | $ # that is all there is | |
2334 | /x; | |
2335 | print "Largest sequence matched was $largest\n"; | |
2336 | ||
2337 | This prints | |
2338 | ||
2339 | It is a Fibonacci sequence | |
2340 | Largest sequence matched was 5 | |
2341 | ||
2342 | Ha! Try that with your garden variety regexp package... | |
2343 | ||
2344 | Note that the variables C<$s0> and C<$s1> are not substituted when the | |
2345 | regexp is compiled, as happens for ordinary variables outside a code | |
2346 | expression. Rather, the code expressions are evaluated when perl | |
2347 | encounters them during the search for a match. | |
2348 | ||
2349 | The regexp without the C<//x> modifier is | |
2350 | ||
2351 | /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/; | |
2352 | ||
2353 | and is a great start on an Obfuscated Perl entry :-) When working with | |
2354 | code and conditional expressions, the extended form of regexps is | |
2355 | almost necessary in creating and debugging regexps. | |
2356 | ||
2357 | =head2 Pragmas and debugging | |
2358 | ||
2359 | Speaking of debugging, there are several pragmas available to control | |
2360 | and debug regexps in Perl. We have already encountered one pragma in | |
2361 | the previous section, S<C<use re 'eval';> >, that allows variable | |
a6b2f353 GS |
2362 | interpolation and code expressions to coexist in a regexp. The other |
2363 | pragmas are | |
47f9c88b GS |
2364 | |
2365 | use re 'taint'; | |
2366 | $tainted = <>; | |
2367 | @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted | |
2368 | ||
2369 | The C<taint> pragma causes any substrings from a match with a tainted | |
2370 | variable to be tainted as well. This is not normally the case, as | |
2371 | regexps are often used to extract the safe bits from a tainted | |
2372 | variable. Use C<taint> when you are not extracting safe bits, but are | |
2373 | performing some other processing. Both C<taint> and C<eval> pragmas | |
a6b2f353 | 2374 | are lexically scoped, which means they are in effect only until |
47f9c88b GS |
2375 | the end of the block enclosing the pragmas. |
2376 | ||
2377 | use re 'debug'; | |
2378 | /^(.*)$/s; # output debugging info | |
2379 | ||
2380 | use re 'debugcolor'; | |
2381 | /^(.*)$/s; # output debugging info in living color | |
2382 | ||
2383 | The global C<debug> and C<debugcolor> pragmas allow one to get | |
2384 | detailed debugging info about regexp compilation and | |
2385 | execution. C<debugcolor> is the same as debug, except the debugging | |
2386 | information is displayed in color on terminals that can display | |
2387 | termcap color sequences. Here is example output: | |
2388 | ||
2389 | % perl -e 'use re "debug"; "abc" =~ /a*b+c/;' | |
2390 | Compiling REx `a*b+c' | |
2391 | size 9 first at 1 | |
2392 | 1: STAR(4) | |
2393 | 2: EXACT <a>(0) | |
2394 | 4: PLUS(7) | |
2395 | 5: EXACT <b>(0) | |
2396 | 7: EXACT <c>(9) | |
2397 | 9: END(0) | |
2398 | floating `bc' at 0..2147483647 (checking floating) minlen 2 | |
2399 | Guessing start of match, REx `a*b+c' against `abc'... | |
2400 | Found floating substr `bc' at offset 1... | |
2401 | Guessed: match at offset 0 | |
2402 | Matching REx `a*b+c' against `abc' | |
2403 | Setting an EVAL scope, savestack=3 | |
2404 | 0 <> <abc> | 1: STAR | |
2405 | EXACT <a> can match 1 times out of 32767... | |
2406 | Setting an EVAL scope, savestack=3 | |
2407 | 1 <a> <bc> | 4: PLUS | |
2408 | EXACT <b> can match 1 times out of 32767... | |
2409 | Setting an EVAL scope, savestack=3 | |
2410 | 2 <ab> <c> | 7: EXACT <c> | |
2411 | 3 <abc> <> | 9: END | |
2412 | Match successful! | |
2413 | Freeing REx: `a*b+c' | |
2414 | ||
2415 | If you have gotten this far into the tutorial, you can probably guess | |
2416 | what the different parts of the debugging output tell you. The first | |
2417 | part | |
2418 | ||
2419 | Compiling REx `a*b+c' | |
2420 | size 9 first at 1 | |
2421 | 1: STAR(4) | |
2422 | 2: EXACT <a>(0) | |
2423 | 4: PLUS(7) | |
2424 | 5: EXACT <b>(0) | |
2425 | 7: EXACT <c>(9) | |
2426 | 9: END(0) | |
2427 | ||
2428 | describes the compilation stage. C<STAR(4)> means that there is a | |
2429 | starred object, in this case C<'a'>, and if it matches, goto line 4, | |
2430 | i.e., C<PLUS(7)>. The middle lines describe some heuristics and | |
2431 | optimizations performed before a match: | |
2432 | ||
2433 | floating `bc' at 0..2147483647 (checking floating) minlen 2 | |
2434 | Guessing start of match, REx `a*b+c' against `abc'... | |
2435 | Found floating substr `bc' at offset 1... | |
2436 | Guessed: match at offset 0 | |
2437 | ||
2438 | Then the match is executed and the remaining lines describe the | |
2439 | process: | |
2440 | ||
2441 | Matching REx `a*b+c' against `abc' | |
2442 | Setting an EVAL scope, savestack=3 | |
2443 | 0 <> <abc> | 1: STAR | |
2444 | EXACT <a> can match 1 times out of 32767... | |
2445 | Setting an EVAL scope, savestack=3 | |
2446 | 1 <a> <bc> | 4: PLUS | |
2447 | EXACT <b> can match 1 times out of 32767... | |
2448 | Setting an EVAL scope, savestack=3 | |
2449 | 2 <ab> <c> | 7: EXACT <c> | |
2450 | 3 <abc> <> | 9: END | |
2451 | Match successful! | |
2452 | Freeing REx: `a*b+c' | |
2453 | ||
2454 | Each step is of the form S<C<< n <x> <y> >> >, with C<< <x> >> the | |
2455 | part of the string matched and C<< <y> >> the part not yet | |
2456 | matched. The S<C<< | 1: STAR >> > says that perl is at line number 1 | |
2457 | n the compilation list above. See | |
2458 | L<perldebguts/"Debugging regular expressions"> for much more detail. | |
2459 | ||
2460 | An alternative method of debugging regexps is to embed C<print> | |
2461 | statements within the regexp. This provides a blow-by-blow account of | |
2462 | the backtracking in an alternation: | |
2463 | ||
2464 | "that this" =~ m@(?{print "Start at position ", pos, "\n";}) | |
2465 | t(?{print "t1\n";}) | |
2466 | h(?{print "h1\n";}) | |
2467 | i(?{print "i1\n";}) | |
2468 | s(?{print "s1\n";}) | |
2469 | | | |
2470 | t(?{print "t2\n";}) | |
2471 | h(?{print "h2\n";}) | |
2472 | a(?{print "a2\n";}) | |
2473 | t(?{print "t2\n";}) | |
2474 | (?{print "Done at position ", pos, "\n";}) | |
2475 | @x; | |
2476 | ||
2477 | prints | |
2478 | ||
2479 | Start at position 0 | |
2480 | t1 | |
2481 | h1 | |
2482 | t2 | |
2483 | h2 | |
2484 | a2 | |
2485 | t2 | |
2486 | Done at position 4 | |
2487 | ||
2488 | =head1 BUGS | |
2489 | ||
2490 | Code expressions, conditional expressions, and independent expressions | |
2491 | are B<experimental>. Don't use them in production code. Yet. | |
2492 | ||
2493 | =head1 SEE ALSO | |
2494 | ||
2495 | This is just a tutorial. For the full story on perl regular | |
2496 | expressions, see the L<perlre> regular expressions reference page. | |
2497 | ||
2498 | For more information on the matching C<m//> and substitution C<s///> | |
2499 | operators, see L<perlop/"Regexp Quote-Like Operators">. For | |
2500 | information on the C<split> operation, see L<perlfunc/split>. | |
2501 | ||
2502 | For an excellent all-around resource on the care and feeding of | |
2503 | regular expressions, see the book I<Mastering Regular Expressions> by | |
2504 | Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3). | |
2505 | ||
2506 | =head1 AUTHOR AND COPYRIGHT | |
2507 | ||
2508 | Copyright (c) 2000 Mark Kvale | |
2509 | All rights reserved. | |
2510 | ||
2511 | This document may be distributed under the same terms as Perl itself. | |
2512 | ||
2513 | =head2 Acknowledgments | |
2514 | ||
2515 | The inspiration for the stop codon DNA example came from the ZIP | |
2516 | code example in chapter 7 of I<Mastering Regular Expressions>. | |
2517 | ||
a6b2f353 GS |
2518 | The author would like to thank Jeff Pinyan, Andrew Johnson, Peter |
2519 | Haworth, Ronald J Kimball, and Joe Smith for all their helpful | |
2520 | comments. | |
47f9c88b GS |
2521 | |
2522 | =cut | |
a6b2f353 | 2523 |