This is a live mirror of the Perl 5 development currently hosted at https://github.com/perl/perl5
Restore strict refs on stashes, removed by ce10b5d1ec5b5f68b0811018a415bc37.
[perl5.git] / pod / perlretut.pod
CommitLineData
47f9c88b
GS
1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting edge innovations in 5.6.0.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
7638d2dc 62What is this Perl statement all about? C<"Hello World"> is a simple
47f9c88b 63double quoted string. C<World> is the regular expression and the
7638d2dc 64C<//> enclosing C</World/> tells Perl to search a string for a match.
47f9c88b
GS
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
7638d2dc 79be reversed by using the C<!~> operator:
47f9c88b
GS
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
a6b2f353
GS
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
47f9c88b
GS
116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
7638d2dc
WL
118same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in this regexp
47f9c88b
GS
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
7638d2dc 131S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space
47f9c88b
GS
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
7638d2dc 140If a regexp matches in more than one place in the string, Perl will
47f9c88b
GS
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
7638d2dc 148is' in a match. Some characters, called I<metacharacters>, are reserved
47f9c88b
GS
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
7638d2dc 161 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
47f9c88b
GS
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
7638d2dc 168 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
47f9c88b
GS
169
170The backslash character C<'\'> is a metacharacter itself and needs to
171be backslashed:
172
173 'C:\WIN32' =~ /C:\\WIN/; # matches
174
175In addition to the metacharacters, there are some ASCII characters
176which don't have printable character equivalents and are instead
7638d2dc 177represented by I<escape sequences>. Common examples are C<\t> for a
47f9c88b
GS
178tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
179bell. If your string is better thought of as a sequence of arbitrary
180bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181sequence, e.g., C<\x1B> may be a more natural representation for your
182bytes. Here are some examples of escapes:
183
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
9f5650a8 187 "cat" =~ /\143\x61\x74/ # matches in ASCII, but a weird way to spell cat
47f9c88b
GS
188
189If you've been around Perl a while, all this talk of escape sequences
190may seem familiar. Similar escape sequences are used in double-quoted
191strings and in fact the regexps in Perl are mostly treated as
192double-quoted strings. This means that variables can be used in
193regexps as well. Just like double-quoted strings, the values of the
194variables in the regexp will be substituted in before the regexp is
195evaluated for matching purposes. So we have:
196
197 $foo = 'house';
198 'housecat' =~ /$foo/; # matches
199 'cathouse' =~ /cat$foo/; # matches
47f9c88b
GS
200 'housecat' =~ /${foo}cat/; # matches
201
202So far, so good. With the knowledge above you can already perform
203searches with just about any literal string regexp you can dream up.
204Here is a I<very simple> emulation of the Unix grep program:
205
206 % cat > simple_grep
207 #!/usr/bin/perl
208 $regexp = shift;
209 while (<>) {
210 print if /$regexp/;
211 }
212 ^D
213
214 % chmod +x simple_grep
215
216 % simple_grep abba /usr/dict/words
217 Babbage
218 cabbage
219 cabbages
220 sabbath
221 Sabbathize
222 Sabbathizes
223 sabbatical
224 scabbard
225 scabbards
226
227This program is easy to understand. C<#!/usr/bin/perl> is the standard
228way to invoke a perl program from the shell.
7638d2dc 229S<C<$regexp = shift;>> saves the first command line argument as the
47f9c88b 230regexp to be used, leaving the rest of the command line arguments to
7638d2dc
WL
231be treated as files. S<C<< while (<>) >>> loops over all the lines in
232all the files. For each line, S<C<print if /$regexp/;>> prints the
47f9c88b
GS
233line if the regexp matches the line. In this line, both C<print> and
234C</$regexp/> use the default variable C<$_> implicitly.
235
236With all of the regexps above, if the regexp matched anywhere in the
237string, it was considered a match. Sometimes, however, we'd like to
238specify I<where> in the string the regexp should try to match. To do
7638d2dc 239this, we would use the I<anchor> metacharacters C<^> and C<$>. The
47f9c88b
GS
240anchor C<^> means match at the beginning of the string and the anchor
241C<$> means match at the end of the string, or before a newline at the
242end of the string. Here is how they are used:
243
244 "housekeeper" =~ /keeper/; # matches
245 "housekeeper" =~ /^keeper/; # doesn't match
246 "housekeeper" =~ /keeper$/; # matches
247 "housekeeper\n" =~ /keeper$/; # matches
248
249The second regexp doesn't match because C<^> constrains C<keeper> to
250match only at the beginning of the string, but C<"housekeeper"> has
251keeper starting in the middle. The third regexp does match, since the
252C<$> constrains C<keeper> to match only at the end of the string.
253
254When both C<^> and C<$> are used at the same time, the regexp has to
255match both the beginning and the end of the string, i.e., the regexp
256matches the whole string. Consider
257
258 "keeper" =~ /^keep$/; # doesn't match
259 "keeper" =~ /^keeper$/; # matches
260 "" =~ /^$/; # ^$ matches an empty string
261
262The first regexp doesn't match because the string has more to it than
263C<keep>. Since the second regexp is exactly the string, it
264matches. Using both C<^> and C<$> in a regexp forces the complete
265string to match, so it gives you complete control over which strings
266match and which don't. Suppose you are looking for a fellow named
267bert, off in a string by himself:
268
269 "dogbert" =~ /bert/; # matches, but not what you want
270
271 "dilbert" =~ /^bert/; # doesn't match, but ..
272 "bertram" =~ /^bert/; # matches, so still not good enough
273
274 "bertram" =~ /^bert$/; # doesn't match, good
275 "dilbert" =~ /^bert$/; # doesn't match, good
276 "bert" =~ /^bert$/; # matches, perfect
277
278Of course, in the case of a literal string, one could just as easily
7638d2dc 279use the string comparison S<C<$string eq 'bert'>> and it would be
47f9c88b
GS
280more efficient. The C<^...$> regexp really becomes useful when we
281add in the more powerful regexp tools below.
282
283=head2 Using character classes
284
285Although one can already do quite a lot with the literal string
286regexps above, we've only scratched the surface of regular expression
287technology. In this and subsequent sections we will introduce regexp
288concepts (and associated metacharacter notations) that will allow a
289regexp to not just represent a single character sequence, but a I<whole
290class> of them.
291
7638d2dc 292One such concept is that of a I<character class>. A character class
47f9c88b
GS
293allows a set of possible characters, rather than just a single
294character, to match at a particular point in a regexp. Character
295classes are denoted by brackets C<[...]>, with the set of characters
296to be possibly matched inside. Here are some examples:
297
298 /cat/; # matches 'cat'
299 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
300 /item[0123456789]/; # matches 'item0' or ... or 'item9'
a6b2f353 301 "abc" =~ /[cab]/; # matches 'a'
47f9c88b
GS
302
303In the last statement, even though C<'c'> is the first character in
304the class, C<'a'> matches because the first character position in the
305string is the earliest point at which the regexp can match.
306
307 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
308 # 'yes', 'Yes', 'YES', etc.
309
da75cd15 310This regexp displays a common task: perform a case-insensitive
28c3722c 311match. Perl provides a way of avoiding all those brackets by simply
47f9c88b
GS
312appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
313can be rewritten as C</yes/i;>. The C<'i'> stands for
7638d2dc 314case-insensitive and is an example of a I<modifier> of the matching
47f9c88b
GS
315operation. We will meet other modifiers later in the tutorial.
316
317We saw in the section above that there were ordinary characters, which
318represented themselves, and special characters, which needed a
319backslash C<\> to represent themselves. The same is true in a
320character class, but the sets of ordinary and special characters
321inside a character class are different than those outside a character
7638d2dc 322class. The special characters for a character class are C<-]\^$> (and
353c6505 323the pattern delimiter, whatever it is).
7638d2dc 324C<]> is special because it denotes the end of a character class. C<$> is
47f9c88b
GS
325special because it denotes a scalar variable. C<\> is special because
326it is used in escape sequences, just like above. Here is how the
327special characters C<]$\> are handled:
328
329 /[\]c]def/; # matches ']def' or 'cdef'
330 $x = 'bcr';
a6b2f353 331 /[$x]at/; # matches 'bat', 'cat', or 'rat'
47f9c88b
GS
332 /[\$x]at/; # matches '$at' or 'xat'
333 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
334
353c6505 335The last two are a little tricky. In C<[\$x]>, the backslash protects
47f9c88b
GS
336the dollar sign, so the character class has two members C<$> and C<x>.
337In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
338variable and substituted in double quote fashion.
339
340The special character C<'-'> acts as a range operator within character
341classes, so that a contiguous set of characters can be written as a
342range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
343become the svelte C<[0-9]> and C<[a-z]>. Some examples are
344
345 /item[0-9]/; # matches 'item0' or ... or 'item9'
346 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
347 # 'baa', 'xaa', 'yaa', or 'zaa'
348 /[0-9a-fA-F]/; # matches a hexadecimal digit
36bbe248 349 /[0-9a-zA-Z_]/; # matches a "word" character,
7638d2dc 350 # like those in a Perl variable name
47f9c88b
GS
351
352If C<'-'> is the first or last character in a character class, it is
353treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
354all equivalent.
355
356The special character C<^> in the first position of a character class
7638d2dc 357denotes a I<negated character class>, which matches any character but
a6b2f353 358those in the brackets. Both C<[...]> and C<[^...]> must match a
47f9c88b
GS
359character, or the match fails. Then
360
361 /[^a]at/; # doesn't match 'aat' or 'at', but matches
362 # all other 'bat', 'cat, '0at', '%at', etc.
363 /[^0-9]/; # matches a non-numeric character
364 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
365
28c3722c 366Now, even C<[0-9]> can be a bother to write multiple times, so in the
47f9c88b 367interest of saving keystrokes and making regexps more readable, Perl
7638d2dc
WL
368has several abbreviations for common character classes, as shown below.
369Since the introduction of Unicode, these character classes match more
370than just a few characters in the ISO 8859-1 range.
47f9c88b
GS
371
372=over 4
373
374=item *
551e1d92 375
7638d2dc 376\d matches a digit, not just [0-9] but also digits from non-roman scripts
47f9c88b
GS
377
378=item *
551e1d92 379
7638d2dc 380\s matches a whitespace character, the set [\ \t\r\n\f] and others
47f9c88b
GS
381
382=item *
551e1d92 383
7638d2dc
WL
384\w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]
385but also digits and characters from non-roman scripts
47f9c88b
GS
386
387=item *
551e1d92 388
7638d2dc 389\D is a negated \d; it represents any other character than a digit, or [^\d]
47f9c88b
GS
390
391=item *
551e1d92 392
47f9c88b
GS
393\S is a negated \s; it represents any non-whitespace character [^\s]
394
395=item *
551e1d92 396
47f9c88b
GS
397\W is a negated \w; it represents any non-word character [^\w]
398
399=item *
551e1d92 400
7638d2dc
WL
401The period '.' matches any character but "\n" (unless the modifier C<//s> is
402in effect, as explained below).
47f9c88b
GS
403
404=back
405
406The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
407of character classes. Here are some in use:
408
409 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
410 /[\d\s]/; # matches any digit or whitespace character
411 /\w\W\w/; # matches a word char, followed by a
412 # non-word char, followed by a word char
413 /..rt/; # matches any two chars, followed by 'rt'
414 /end\./; # matches 'end.'
415 /end[.]/; # same thing, matches 'end.'
416
417Because a period is a metacharacter, it needs to be escaped to match
418as an ordinary period. Because, for example, C<\d> and C<\w> are sets
419of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
420fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
421C<[\W]>. Think DeMorgan's laws.
422
7638d2dc 423An anchor useful in basic regexps is the I<word anchor>
47f9c88b
GS
424C<\b>. This matches a boundary between a word character and a non-word
425character C<\w\W> or C<\W\w>:
426
427 $x = "Housecat catenates house and cat";
428 $x =~ /cat/; # matches cat in 'housecat'
429 $x =~ /\bcat/; # matches cat in 'catenates'
430 $x =~ /cat\b/; # matches cat in 'housecat'
431 $x =~ /\bcat\b/; # matches 'cat' at end of string
432
433Note in the last example, the end of the string is considered a word
434boundary.
435
436You might wonder why C<'.'> matches everything but C<"\n"> - why not
437every character? The reason is that often one is matching against
438lines and would like to ignore the newline characters. For instance,
439while the string C<"\n"> represents one line, we would like to think
28c3722c 440of it as empty. Then
47f9c88b
GS
441
442 "" =~ /^$/; # matches
7638d2dc 443 "\n" =~ /^$/; # matches, $ anchors before "\n"
47f9c88b
GS
444
445 "" =~ /./; # doesn't match; it needs a char
446 "" =~ /^.$/; # doesn't match; it needs a char
447 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
448 "a" =~ /^.$/; # matches
7638d2dc 449 "a\n" =~ /^.$/; # matches, $ anchors before "\n"
47f9c88b
GS
450
451This behavior is convenient, because we usually want to ignore
452newlines when we count and match characters in a line. Sometimes,
453however, we want to keep track of newlines. We might even want C<^>
454and C<$> to anchor at the beginning and end of lines within the
455string, rather than just the beginning and end of the string. Perl
456allows us to choose between ignoring and paying attention to newlines
457by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
458single line and multi-line and they determine whether a string is to
459be treated as one continuous string, or as a set of lines. The two
460modifiers affect two aspects of how the regexp is interpreted: 1) how
461the C<'.'> character class is defined, and 2) where the anchors C<^>
462and C<$> are able to match. Here are the four possible combinations:
463
464=over 4
465
466=item *
551e1d92 467
47f9c88b
GS
468no modifiers (//): Default behavior. C<'.'> matches any character
469except C<"\n">. C<^> matches only at the beginning of the string and
470C<$> matches only at the end or before a newline at the end.
471
472=item *
551e1d92 473
47f9c88b
GS
474s modifier (//s): Treat string as a single long line. C<'.'> matches
475any character, even C<"\n">. C<^> matches only at the beginning of
476the string and C<$> matches only at the end or before a newline at the
477end.
478
479=item *
551e1d92 480
47f9c88b
GS
481m modifier (//m): Treat string as a set of multiple lines. C<'.'>
482matches any character except C<"\n">. C<^> and C<$> are able to match
483at the start or end of I<any> line within the string.
484
485=item *
551e1d92 486
47f9c88b
GS
487both s and m modifiers (//sm): Treat string as a single long line, but
488detect multiple lines. C<'.'> matches any character, even
489C<"\n">. C<^> and C<$>, however, are able to match at the start or end
490of I<any> line within the string.
491
492=back
493
494Here are examples of C<//s> and C<//m> in action:
495
496 $x = "There once was a girl\nWho programmed in Perl\n";
497
498 $x =~ /^Who/; # doesn't match, "Who" not at start of string
499 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
500 $x =~ /^Who/m; # matches, "Who" at start of second line
501 $x =~ /^Who/sm; # matches, "Who" at start of second line
502
503 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
504 $x =~ /girl.Who/s; # matches, "." matches "\n"
505 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
506 $x =~ /girl.Who/sm; # matches, "." matches "\n"
507
3c12f9b9 508Most of the time, the default behavior is what is wanted, but C<//s> and
47f9c88b 509C<//m> are occasionally very useful. If C<//m> is being used, the start
28c3722c 510of the string can still be matched with C<\A> and the end of the string
47f9c88b
GS
511can still be matched with the anchors C<\Z> (matches both the end and
512the newline before, like C<$>), and C<\z> (matches only the end):
513
514 $x =~ /^Who/m; # matches, "Who" at start of second line
515 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
516
517 $x =~ /girl$/m; # matches, "girl" at end of first line
518 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
519
520 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
521 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
522
523We now know how to create choices among classes of characters in a
524regexp. What about choices among words or character strings? Such
525choices are described in the next section.
526
527=head2 Matching this or that
528
28c3722c 529Sometimes we would like our regexp to be able to match different
47f9c88b 530possible words or character strings. This is accomplished by using
7638d2dc
WL
531the I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
532form the regexp C<dog|cat>. As before, Perl will try to match the
47f9c88b 533regexp at the earliest possible point in the string. At each
7638d2dc
WL
534character position, Perl will first try to match the first
535alternative, C<dog>. If C<dog> doesn't match, Perl will then try the
47f9c88b 536next alternative, C<cat>. If C<cat> doesn't match either, then the
7638d2dc 537match fails and Perl moves to the next position in the string. Some
47f9c88b
GS
538examples:
539
540 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
541 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
542
543Even though C<dog> is the first alternative in the second regexp,
544C<cat> is able to match earlier in the string.
545
546 "cats" =~ /c|ca|cat|cats/; # matches "c"
547 "cats" =~ /cats|cat|ca|c/; # matches "cats"
548
549Here, all the alternatives match at the first string position, so the
550first alternative is the one that matches. If some of the
551alternatives are truncations of the others, put the longest ones first
552to give them a chance to match.
553
554 "cab" =~ /a|b|c/ # matches "c"
555 # /a|b|c/ == /[abc]/
556
557The last example points out that character classes are like
558alternations of characters. At a given character position, the first
210b36aa 559alternative that allows the regexp match to succeed will be the one
47f9c88b
GS
560that matches.
561
562=head2 Grouping things and hierarchical matching
563
564Alternation allows a regexp to choose among alternatives, but by
7638d2dc 565itself it is unsatisfying. The reason is that each alternative is a whole
47f9c88b
GS
566regexp, but sometime we want alternatives for just part of a
567regexp. For instance, suppose we want to search for housecats or
568housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
569inefficient because we had to type C<house> twice. It would be nice to
da75cd15 570have parts of the regexp be constant, like C<house>, and some
47f9c88b
GS
571parts have alternatives, like C<cat|keeper>.
572
7638d2dc 573The I<grouping> metacharacters C<()> solve this problem. Grouping
47f9c88b
GS
574allows parts of a regexp to be treated as a single unit. Parts of a
575regexp are grouped by enclosing them in parentheses. Thus we could solve
576the C<housecat|housekeeper> by forming the regexp as
577C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
578C<house> followed by either C<cat> or C<keeper>. Some more examples
579are
580
581 /(a|b)b/; # matches 'ab' or 'bb'
582 /(ac|b)b/; # matches 'acb' or 'bb'
583 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
584 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
585
586 /house(cat|)/; # matches either 'housecat' or 'house'
587 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
588 # 'house'. Note groups can be nested.
589
590 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
591 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
592 # because '20\d\d' can't match
593
594Alternations behave the same way in groups as out of them: at a given
595string position, the leftmost alternative that allows the regexp to
210b36aa 596match is taken. So in the last example at the first string position,
47f9c88b 597C<"20"> matches the second alternative, but there is nothing left over
7638d2dc 598to match the next two digits C<\d\d>. So Perl moves on to the next
47f9c88b
GS
599alternative, which is the null alternative and that works, since
600C<"20"> is two digits.
601
602The process of trying one alternative, seeing if it matches, and
7638d2dc
WL
603moving on to the next alternative, while going back in the string
604from where the previous alternative was tried, if it doesn't, is called
605I<backtracking>. The term 'backtracking' comes from the idea that
47f9c88b
GS
606matching a regexp is like a walk in the woods. Successfully matching
607a regexp is like arriving at a destination. There are many possible
608trailheads, one for each string position, and each one is tried in
609order, left to right. From each trailhead there may be many paths,
610some of which get you there, and some which are dead ends. When you
611walk along a trail and hit a dead end, you have to backtrack along the
612trail to an earlier point to try another trail. If you hit your
613destination, you stop immediately and forget about trying all the
614other trails. You are persistent, and only if you have tried all the
615trails from all the trailheads and not arrived at your destination, do
616you declare failure. To be concrete, here is a step-by-step analysis
7638d2dc 617of what Perl does when it tries to match the regexp
47f9c88b
GS
618
619 "abcde" =~ /(abd|abc)(df|d|de)/;
620
621=over 4
622
551e1d92
RB
623=item 0
624
625Start with the first letter in the string 'a'.
626
627=item 1
47f9c88b 628
551e1d92 629Try the first alternative in the first group 'abd'.
47f9c88b 630
551e1d92 631=item 2
47f9c88b 632
551e1d92
RB
633Match 'a' followed by 'b'. So far so good.
634
635=item 3
636
637'd' in the regexp doesn't match 'c' in the string - a dead
47f9c88b
GS
638end. So backtrack two characters and pick the second alternative in
639the first group 'abc'.
640
551e1d92
RB
641=item 4
642
643Match 'a' followed by 'b' followed by 'c'. We are on a roll
47f9c88b
GS
644and have satisfied the first group. Set $1 to 'abc'.
645
551e1d92
RB
646=item 5
647
648Move on to the second group and pick the first alternative
47f9c88b
GS
649'df'.
650
551e1d92 651=item 6
47f9c88b 652
551e1d92
RB
653Match the 'd'.
654
655=item 7
656
657'f' in the regexp doesn't match 'e' in the string, so a dead
47f9c88b
GS
658end. Backtrack one character and pick the second alternative in the
659second group 'd'.
660
551e1d92
RB
661=item 8
662
663'd' matches. The second grouping is satisfied, so set $2 to
47f9c88b
GS
664'd'.
665
551e1d92
RB
666=item 9
667
668We are at the end of the regexp, so we are done! We have
47f9c88b
GS
669matched 'abcd' out of the string "abcde".
670
671=back
672
673There are a couple of things to note about this analysis. First, the
674third alternative in the second group 'de' also allows a match, but we
675stopped before we got to it - at a given character position, leftmost
676wins. Second, we were able to get a match at the first character
677position of the string 'a'. If there were no matches at the first
7638d2dc 678position, Perl would move to the second character position 'b' and
47f9c88b 679attempt the match all over again. Only when all possible paths at all
7638d2dc
WL
680possible character positions have been exhausted does Perl give
681up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false.
47f9c88b
GS
682
683Even with all this work, regexp matching happens remarkably fast. To
353c6505
DL
684speed things up, Perl compiles the regexp into a compact sequence of
685opcodes that can often fit inside a processor cache. When the code is
7638d2dc
WL
686executed, these opcodes can then run at full throttle and search very
687quickly.
47f9c88b
GS
688
689=head2 Extracting matches
690
691The grouping metacharacters C<()> also serve another completely
692different function: they allow the extraction of the parts of a string
693that matched. This is very useful to find out what matched and for
694text processing in general. For each grouping, the part that matched
695inside goes into the special variables C<$1>, C<$2>, etc. They can be
696used just as ordinary variables:
697
698 # extract hours, minutes, seconds
2275acdc
RGS
699 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
700 $hours = $1;
701 $minutes = $2;
702 $seconds = $3;
703 }
47f9c88b
GS
704
705Now, we know that in scalar context,
7638d2dc 706S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false
47f9c88b
GS
707value. In list context, however, it returns the list of matched values
708C<($1,$2,$3)>. So we could write the code more compactly as
709
710 # extract hours, minutes, seconds
711 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
712
713If the groupings in a regexp are nested, C<$1> gets the group with the
714leftmost opening parenthesis, C<$2> the next opening parenthesis,
7638d2dc 715etc. Here is a regexp with nested groups:
47f9c88b
GS
716
717 /(ab(cd|ef)((gi)|j))/;
718 1 2 34
719
7638d2dc
WL
720If this regexp matches, C<$1> contains a string starting with
721C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either
722C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>,
723or it remains undefined.
724
725For convenience, Perl sets C<$+> to the string held by the highest numbered
726C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the
727value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>,
728C<$2>,... associated with the rightmost closing parenthesis used in the
a01268b5 729match).
47f9c88b 730
7638d2dc
WL
731
732=head2 Backreferences
733
47f9c88b 734Closely associated with the matching variables C<$1>, C<$2>, ... are
7638d2dc 735the I<backreferences> C<\1>, C<\2>,... Backreferences are simply
47f9c88b 736matching variables that can be used I<inside> a regexp. This is a
ac036724 737really nice feature; what matches later in a regexp is made to depend on
47f9c88b 738what matched earlier in the regexp. Suppose we wanted to look
7638d2dc 739for doubled words in a text, like 'the the'. The following regexp finds
47f9c88b
GS
740all 3-letter doubles with a space in between:
741
7638d2dc 742 /\b(\w\w\w)\s\1\b/;
47f9c88b
GS
743
744The grouping assigns a value to \1, so that the same 3 letter sequence
7638d2dc
WL
745is used for both parts.
746
747A similar task is to find words consisting of two identical parts:
47f9c88b
GS
748
749 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
750 beriberi
751 booboo
752 coco
753 mama
754 murmur
755 papa
756
757The regexp has a single grouping which considers 4-letter
7638d2dc 758combinations, then 3-letter combinations, etc., and uses C<\1> to look for
47f9c88b 759a repeat. Although C<$1> and C<\1> represent the same thing, care should be
7638d2dc
WL
760taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp
761and backreferences C<\1>, C<\2>,... only I<inside> a regexp; not doing
762so may lead to surprising and unsatisfactory results.
763
764
765=head2 Relative backreferences
766
767Counting the opening parentheses to get the correct number for a
353c6505 768backreference is errorprone as soon as there is more than one
7638d2dc
WL
769capturing group. A more convenient technique became available
770with Perl 5.10: relative backreferences. To refer to the immediately
771preceding capture group one now may write C<\g{-1}>, the next but
772last is available via C<\g{-2}>, and so on.
773
774Another good reason in addition to readability and maintainability
775for using relative backreferences is illustrated by the following example,
776where a simple pattern for matching peculiar strings is used:
777
353c6505 778 $a99a = '([a-z])(\d)\2\1'; # matches a11a, g22g, x33x, etc.
7638d2dc
WL
779
780Now that we have this pattern stored as a handy string, we might feel
781tempted to use it as a part of some other pattern:
782
783 $line = "code=e99e";
784 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
785 print "$1 is valid\n";
786 } else {
787 print "bad line: '$line'\n";
788 }
789
ac036724 790But this doesn't match, at least not the way one might expect. Only
7638d2dc
WL
791after inserting the interpolated C<$a99a> and looking at the resulting
792full text of the regexp is it obvious that the backreferences have
ac036724 793backfired. The subexpression C<(\w+)> has snatched number 1 and
7638d2dc
WL
794demoted the groups in C<$a99a> by one rank. This can be avoided by
795using relative backreferences:
796
797 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
798
799
800=head2 Named backreferences
801
802Perl 5.10 also introduced named capture buffers and named backreferences.
803To attach a name to a capturing group, you write either
804C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may
805then be written as C<\g{name}>. It is permissible to attach the
806same name to more than one group, but then only the leftmost one of the
807eponymous set can be referenced. Outside of the pattern a named
808capture buffer is accessible through the C<%+> hash.
809
353c6505 810Assuming that we have to match calendar dates which may be given in one
7638d2dc 811of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
353c6505 812three suitable patterns where we use 'd', 'm' and 'y' respectively as the
7638d2dc
WL
813names of the buffers capturing the pertaining components of a date. The
814matching operation combines the three patterns as alternatives:
815
816 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
817 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
818 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
819 for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
820 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
821 print "day=$+{d} month=$+{m} year=$+{y}\n";
822 }
823 }
824
825If any of the alternatives matches, the hash C<%+> is bound to contain the
826three key-value pairs.
827
828
829=head2 Alternative capture group numbering
830
831Yet another capturing group numbering technique (also as from Perl 5.10)
832deals with the problem of referring to groups within a set of alternatives.
833Consider a pattern for matching a time of the day, civil or military style:
47f9c88b 834
7638d2dc
WL
835 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
836 # process hour and minute
837 }
838
839Processing the results requires an additional if statement to determine
353c6505 840whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would
7638d2dc 841be easier if we could use buffer numbers 1 and 2 in second alternative as
353c6505 842well, and this is exactly what the parenthesized construct C<(?|...)>,
7638d2dc
WL
843set around an alternative achieves. Here is an extended version of the
844previous pattern:
845
846 if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
847 print "hour=$1 minute=$2 zone=$3\n";
848 }
849
850Within the alternative numbering group, buffer numbers start at the same
851position for each alternative. After the group, numbering continues
353c6505 852with one higher than the maximum reached across all the alternatives.
7638d2dc
WL
853
854=head2 Position information
855
856In addition to what was matched, Perl (since 5.6.0) also provides the
857positions of what was matched as contents of the C<@-> and C<@+>
47f9c88b
GS
858arrays. C<$-[0]> is the position of the start of the entire match and
859C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
860position of the start of the C<$n> match and C<$+[n]> is the position
861of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
862this code
863
864 $x = "Mmm...donut, thought Homer";
865 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
866 foreach $expr (1..$#-) {
867 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
868 }
869
870prints
871
872 Match 1: 'Mmm' at position (0,3)
873 Match 2: 'donut' at position (6,11)
874
875Even if there are no groupings in a regexp, it is still possible to
7638d2dc 876find out what exactly matched in a string. If you use them, Perl
47f9c88b
GS
877will set C<$`> to the part of the string before the match, will set C<$&>
878to the part of the string that matched, and will set C<$'> to the part
879of the string after the match. An example:
880
881 $x = "the cat caught the mouse";
882 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
883 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
884
7638d2dc
WL
885In the second match, C<$`> equals C<''> because the regexp matched at the
886first character position in the string and stopped; it never saw the
47f9c88b 887second 'the'. It is important to note that using C<$`> and C<$'>
7638d2dc 888slows down regexp matching quite a bit, while C<$&> slows it down to a
47f9c88b 889lesser extent, because if they are used in one regexp in a program,
7638d2dc 890they are generated for I<all> regexps in the program. So if raw
47f9c88b 891performance is a goal of your application, they should be avoided.
7638d2dc
WL
892If you need to extract the corresponding substrings, use C<@-> and
893C<@+> instead:
47f9c88b
GS
894
895 $` is the same as substr( $x, 0, $-[0] )
896 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
897 $' is the same as substr( $x, $+[0] )
898
7638d2dc
WL
899
900=head2 Non-capturing groupings
901
353c6505 902A group that is required to bundle a set of alternatives may or may not be
7638d2dc
WL
903useful as a capturing group. If it isn't, it just creates a superfluous
904addition to the set of available capture buffer values, inside as well as
905outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>,
353c6505 906still allow the regexp to be treated as a single unit, but don't establish
7638d2dc
WL
907a capturing buffer at the same time. Both capturing and non-capturing
908groupings are allowed to co-exist in the same regexp. Because there is
909no extraction, non-capturing groupings are faster than capturing
910groupings. Non-capturing groupings are also handy for choosing exactly
911which parts of a regexp are to be extracted to matching variables:
912
913 # match a number, $1-$4 are set, but we only want $1
914 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
915
916 # match a number faster , only $1 is set
917 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
918
919 # match a number, get $1 = whole number, $2 = exponent
920 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
921
922Non-capturing groupings are also useful for removing nuisance
923elements gathered from a split operation where parentheses are
924required for some reason:
925
926 $x = '12aba34ba5';
927 @num = split /(a|b)+/, $x; # @num = ('12','a','34','b','5')
928 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
929
930
47f9c88b
GS
931=head2 Matching repetitions
932
933The examples in the previous section display an annoying weakness. We
7638d2dc
WL
934were only matching 3-letter words, or chunks of words of 4 letters or
935less. We'd like to be able to match words or, more generally, strings
936of any length, without writing out tedious alternatives like
47f9c88b
GS
937C<\w\w\w\w|\w\w\w|\w\w|\w>.
938
7638d2dc
WL
939This is exactly the problem the I<quantifier> metacharacters C<?>,
940C<*>, C<+>, and C<{}> were created for. They allow us to delimit the
941number of repeats for a portion of a regexp we consider to be a
47f9c88b
GS
942match. Quantifiers are put immediately after the character, character
943class, or grouping that we want to specify. They have the following
944meanings:
945
946=over 4
947
551e1d92 948=item *
47f9c88b 949
7638d2dc 950C<a?> means: match 'a' 1 or 0 times
47f9c88b 951
551e1d92
RB
952=item *
953
7638d2dc 954C<a*> means: match 'a' 0 or more times, i.e., any number of times
551e1d92
RB
955
956=item *
47f9c88b 957
7638d2dc 958C<a+> means: match 'a' 1 or more times, i.e., at least once
551e1d92
RB
959
960=item *
961
7638d2dc 962C<a{n,m}> means: match at least C<n> times, but not more than C<m>
47f9c88b
GS
963times.
964
551e1d92
RB
965=item *
966
7638d2dc 967C<a{n,}> means: match at least C<n> or more times
551e1d92
RB
968
969=item *
47f9c88b 970
7638d2dc 971C<a{n}> means: match exactly C<n> times
47f9c88b
GS
972
973=back
974
975Here are some examples:
976
7638d2dc 977 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
47f9c88b
GS
978 # any number of digits
979 /(\w+)\s+\1/; # match doubled words of arbitrary length
980 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
981 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
982 # than 4 digits
983 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
984 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
985 # this produces $1 and the other does not.
986
987 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
988 beriberi
989 booboo
990 coco
991 mama
992 murmur
993 papa
994
7638d2dc 995For all of these quantifiers, Perl will try to match as much of the
47f9c88b 996string as possible, while still allowing the regexp to succeed. Thus
7638d2dc
WL
997with C</a?.../>, Perl will first try to match the regexp with the C<a>
998present; if that fails, Perl will try to match the regexp without the
47f9c88b
GS
999C<a> present. For the quantifier C<*>, we get the following:
1000
1001 $x = "the cat in the hat";
1002 $x =~ /^(.*)(cat)(.*)$/; # matches,
1003 # $1 = 'the '
1004 # $2 = 'cat'
1005 # $3 = ' in the hat'
1006
1007Which is what we might expect, the match finds the only C<cat> in the
1008string and locks onto it. Consider, however, this regexp:
1009
1010 $x =~ /^(.*)(at)(.*)$/; # matches,
1011 # $1 = 'the cat in the h'
1012 # $2 = 'at'
7638d2dc 1013 # $3 = '' (0 characters match)
47f9c88b 1014
7638d2dc 1015One might initially guess that Perl would find the C<at> in C<cat> and
47f9c88b
GS
1016stop there, but that wouldn't give the longest possible string to the
1017first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
1018much of the string as possible while still having the regexp match. In
a6b2f353 1019this example, that means having the C<at> sequence with the final C<at>
47f9c88b
GS
1020in the string. The other important principle illustrated here is that
1021when there are two or more elements in a regexp, the I<leftmost>
1022quantifier, if there is one, gets to grab as much the string as
1023possible, leaving the rest of the regexp to fight over scraps. Thus in
1024our example, the first quantifier C<.*> grabs most of the string, while
1025the second quantifier C<.*> gets the empty string. Quantifiers that
7638d2dc
WL
1026grab as much of the string as possible are called I<maximal match> or
1027I<greedy> quantifiers.
47f9c88b
GS
1028
1029When a regexp can match a string in several different ways, we can use
1030the principles above to predict which way the regexp will match:
1031
1032=over 4
1033
1034=item *
551e1d92 1035
47f9c88b
GS
1036Principle 0: Taken as a whole, any regexp will be matched at the
1037earliest possible position in the string.
1038
1039=item *
551e1d92 1040
47f9c88b
GS
1041Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
1042that allows a match for the whole regexp will be the one used.
1043
1044=item *
551e1d92 1045
47f9c88b
GS
1046Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
1047C<{n,m}> will in general match as much of the string as possible while
1048still allowing the whole regexp to match.
1049
1050=item *
551e1d92 1051
47f9c88b
GS
1052Principle 3: If there are two or more elements in a regexp, the
1053leftmost greedy quantifier, if any, will match as much of the string
1054as possible while still allowing the whole regexp to match. The next
1055leftmost greedy quantifier, if any, will try to match as much of the
1056string remaining available to it as possible, while still allowing the
1057whole regexp to match. And so on, until all the regexp elements are
1058satisfied.
1059
1060=back
1061
ac036724 1062As we have seen above, Principle 0 overrides the others. The regexp
47f9c88b
GS
1063will be matched as early as possible, with the other principles
1064determining how the regexp matches at that earliest character
1065position.
1066
1067Here is an example of these principles in action:
1068
1069 $x = "The programming republic of Perl";
1070 $x =~ /^(.+)(e|r)(.*)$/; # matches,
1071 # $1 = 'The programming republic of Pe'
1072 # $2 = 'r'
1073 # $3 = 'l'
1074
1075This regexp matches at the earliest string position, C<'T'>. One
1076might think that C<e>, being leftmost in the alternation, would be
1077matched, but C<r> produces the longest string in the first quantifier.
1078
1079 $x =~ /(m{1,2})(.*)$/; # matches,
1080 # $1 = 'mm'
1081 # $2 = 'ing republic of Perl'
1082
1083Here, The earliest possible match is at the first C<'m'> in
1084C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
1085a maximal C<mm>.
1086
1087 $x =~ /.*(m{1,2})(.*)$/; # matches,
1088 # $1 = 'm'
1089 # $2 = 'ing republic of Perl'
1090
1091Here, the regexp matches at the start of the string. The first
1092quantifier C<.*> grabs as much as possible, leaving just a single
1093C<'m'> for the second quantifier C<m{1,2}>.
1094
1095 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
1096 # $1 = 'a'
1097 # $2 = 'mm'
1098 # $3 = 'ing republic of Perl'
1099
1100Here, C<.?> eats its maximal one character at the earliest possible
1101position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
1102the opportunity to match both C<m>'s. Finally,
1103
1104 "aXXXb" =~ /(X*)/; # matches with $1 = ''
1105
1106because it can match zero copies of C<'X'> at the beginning of the
1107string. If you definitely want to match at least one C<'X'>, use
1108C<X+>, not C<X*>.
1109
1110Sometimes greed is not good. At times, we would like quantifiers to
1111match a I<minimal> piece of string, rather than a maximal piece. For
7638d2dc
WL
1112this purpose, Larry Wall created the I<minimal match> or
1113I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are
47f9c88b
GS
1114the usual quantifiers with a C<?> appended to them. They have the
1115following meanings:
1116
1117=over 4
1118
551e1d92
RB
1119=item *
1120
7638d2dc 1121C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1.
47f9c88b 1122
551e1d92
RB
1123=item *
1124
7638d2dc 1125C<a*?> means: match 'a' 0 or more times, i.e., any number of times,
47f9c88b
GS
1126but as few times as possible
1127
551e1d92
RB
1128=item *
1129
7638d2dc 1130C<a+?> means: match 'a' 1 or more times, i.e., at least once, but
47f9c88b
GS
1131as few times as possible
1132
551e1d92
RB
1133=item *
1134
7638d2dc 1135C<a{n,m}?> means: match at least C<n> times, not more than C<m>
47f9c88b
GS
1136times, as few times as possible
1137
551e1d92
RB
1138=item *
1139
7638d2dc 1140C<a{n,}?> means: match at least C<n> times, but as few times as
47f9c88b
GS
1141possible
1142
551e1d92
RB
1143=item *
1144
7638d2dc 1145C<a{n}?> means: match exactly C<n> times. Because we match exactly
47f9c88b
GS
1146C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1147notational consistency.
1148
1149=back
1150
1151Let's look at the example above, but with minimal quantifiers:
1152
1153 $x = "The programming republic of Perl";
1154 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1155 # $1 = 'Th'
1156 # $2 = 'e'
1157 # $3 = ' programming republic of Perl'
1158
1159The minimal string that will allow both the start of the string C<^>
1160and the alternation to match is C<Th>, with the alternation C<e|r>
1161matching C<e>. The second quantifier C<.*> is free to gobble up the
1162rest of the string.
1163
1164 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1165 # $1 = 'm'
1166 # $2 = 'ming republic of Perl'
1167
1168The first string position that this regexp can match is at the first
1169C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1170matches just one C<'m'>. Although the second quantifier C<.*?> would
1171prefer to match no characters, it is constrained by the end-of-string
1172anchor C<$> to match the rest of the string.
1173
1174 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1175 # $1 = 'The progra'
1176 # $2 = 'm'
1177 # $3 = 'ming republic of Perl'
1178
1179In this regexp, you might expect the first minimal quantifier C<.*?>
1180to match the empty string, because it is not constrained by a C<^>
1181anchor to match the beginning of the word. Principle 0 applies here,
1182however. Because it is possible for the whole regexp to match at the
1183start of the string, it I<will> match at the start of the string. Thus
1184the first quantifier has to match everything up to the first C<m>. The
1185second minimal quantifier matches just one C<m> and the third
1186quantifier matches the rest of the string.
1187
1188 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1189 # $1 = 'a'
1190 # $2 = 'mm'
1191 # $3 = 'ing republic of Perl'
1192
1193Just as in the previous regexp, the first quantifier C<.??> can match
1194earliest at position C<'a'>, so it does. The second quantifier is
1195greedy, so it matches C<mm>, and the third matches the rest of the
1196string.
1197
1198We can modify principle 3 above to take into account non-greedy
1199quantifiers:
1200
1201=over 4
1202
1203=item *
551e1d92 1204
47f9c88b
GS
1205Principle 3: If there are two or more elements in a regexp, the
1206leftmost greedy (non-greedy) quantifier, if any, will match as much
1207(little) of the string as possible while still allowing the whole
1208regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1209any, will try to match as much (little) of the string remaining
1210available to it as possible, while still allowing the whole regexp to
1211match. And so on, until all the regexp elements are satisfied.
1212
1213=back
1214
1215Just like alternation, quantifiers are also susceptible to
1216backtracking. Here is a step-by-step analysis of the example
1217
1218 $x = "the cat in the hat";
1219 $x =~ /^(.*)(at)(.*)$/; # matches,
1220 # $1 = 'the cat in the h'
1221 # $2 = 'at'
1222 # $3 = '' (0 matches)
1223
1224=over 4
1225
551e1d92
RB
1226=item 0
1227
1228Start with the first letter in the string 't'.
47f9c88b 1229
551e1d92
RB
1230=item 1
1231
1232The first quantifier '.*' starts out by matching the whole
47f9c88b
GS
1233string 'the cat in the hat'.
1234
551e1d92
RB
1235=item 2
1236
1237'a' in the regexp element 'at' doesn't match the end of the
47f9c88b
GS
1238string. Backtrack one character.
1239
551e1d92
RB
1240=item 3
1241
1242'a' in the regexp element 'at' still doesn't match the last
47f9c88b
GS
1243letter of the string 't', so backtrack one more character.
1244
551e1d92
RB
1245=item 4
1246
1247Now we can match the 'a' and the 't'.
47f9c88b 1248
551e1d92
RB
1249=item 5
1250
1251Move on to the third element '.*'. Since we are at the end of
47f9c88b
GS
1252the string and '.*' can match 0 times, assign it the empty string.
1253
551e1d92
RB
1254=item 6
1255
1256We are done!
47f9c88b
GS
1257
1258=back
1259
1260Most of the time, all this moving forward and backtracking happens
7638d2dc 1261quickly and searching is fast. There are some pathological regexps,
47f9c88b
GS
1262however, whose execution time exponentially grows with the size of the
1263string. A typical structure that blows up in your face is of the form
1264
1265 /(a|b+)*/;
1266
1267The problem is the nested indeterminate quantifiers. There are many
1268different ways of partitioning a string of length n between the C<+>
1269and C<*>: one repetition with C<b+> of length n, two repetitions with
1270the first C<b+> length k and the second with length n-k, m repetitions
1271whose bits add up to length n, etc. In fact there are an exponential
7638d2dc 1272number of ways to partition a string as a function of its length. A
47f9c88b 1273regexp may get lucky and match early in the process, but if there is
7638d2dc 1274no match, Perl will try I<every> possibility before giving up. So be
47f9c88b 1275careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
7638d2dc 1276I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful
47f9c88b
GS
1277discussion of this and other efficiency issues.
1278
7638d2dc
WL
1279
1280=head2 Possessive quantifiers
1281
1282Backtracking during the relentless search for a match may be a waste
1283of time, particularly when the match is bound to fail. Consider
1284the simple pattern
1285
1286 /^\w+\s+\w+$/; # a word, spaces, a word
1287
1288Whenever this is applied to a string which doesn't quite meet the
1289pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>,
353c6505
DL
1290the regex engine will backtrack, approximately once for each character
1291in the string. But we know that there is no way around taking I<all>
1292of the initial word characters to match the first repetition, that I<all>
7638d2dc 1293spaces must be eaten by the middle part, and the same goes for the second
353c6505
DL
1294word.
1295
1296With the introduction of the I<possessive quantifiers> in Perl 5.10, we
1297have a way of instructing the regex engine not to backtrack, with the
1298usual quantifiers with a C<+> appended to them. This makes them greedy as
1299well as stingy; once they succeed they won't give anything back to permit
1300another solution. They have the following meanings:
7638d2dc
WL
1301
1302=over 4
1303
1304=item *
1305
353c6505
DL
1306C<a{n,m}+> means: match at least C<n> times, not more than C<m> times,
1307as many times as possible, and don't give anything up. C<a?+> is short
7638d2dc
WL
1308for C<a{0,1}+>
1309
1310=item *
1311
1312C<a{n,}+> means: match at least C<n> times, but as many times as possible,
353c6505 1313and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is
7638d2dc
WL
1314short for C<a{1,}+>.
1315
1316=item *
1317
1318C<a{n}+> means: match exactly C<n> times. It is just there for
1319notational consistency.
1320
1321=back
1322
353c6505
DL
1323These possessive quantifiers represent a special case of a more general
1324concept, the I<independent subexpression>, see below.
7638d2dc
WL
1325
1326As an example where a possessive quantifier is suitable we consider
1327matching a quoted string, as it appears in several programming languages.
1328The backslash is used as an escape character that indicates that the
1329next character is to be taken literally, as another character for the
1330string. Therefore, after the opening quote, we expect a (possibly
353c6505 1331empty) sequence of alternatives: either some character except an
7638d2dc
WL
1332unescaped quote or backslash or an escaped character.
1333
1334 /"(?:[^"\\]++|\\.)*+"/;
1335
1336
47f9c88b
GS
1337=head2 Building a regexp
1338
1339At this point, we have all the basic regexp concepts covered, so let's
1340give a more involved example of a regular expression. We will build a
1341regexp that matches numbers.
1342
1343The first task in building a regexp is to decide what we want to match
1344and what we want to exclude. In our case, we want to match both
1345integers and floating point numbers and we want to reject any string
1346that isn't a number.
1347
1348The next task is to break the problem down into smaller problems that
1349are easily converted into a regexp.
1350
1351The simplest case is integers. These consist of a sequence of digits,
1352with an optional sign in front. The digits we can represent with
1353C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1354regexp is
1355
1356 /[+-]?\d+/; # matches integers
1357
1358A floating point number potentially has a sign, an integral part, a
1359decimal point, a fractional part, and an exponent. One or more of these
1360parts is optional, so we need to check out the different
1361possibilities. Floating point numbers which are in proper form include
1362123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1363front is completely optional and can be matched by C<[+-]?>. We can
1364see that if there is no exponent, floating point numbers must have a
1365decimal point, otherwise they are integers. We might be tempted to
1366model these with C<\d*\.\d*>, but this would also match just a single
1367decimal point, which is not a number. So the three cases of floating
7638d2dc 1368point number without exponent are
47f9c88b
GS
1369
1370 /[+-]?\d+\./; # 1., 321., etc.
1371 /[+-]?\.\d+/; # .1, .234, etc.
1372 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1373
1374These can be combined into a single regexp with a three-way alternation:
1375
1376 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1377
1378In this alternation, it is important to put C<'\d+\.\d+'> before
1379C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1380and ignore the fractional part of the number.
1381
1382Now consider floating point numbers with exponents. The key
1383observation here is that I<both> integers and numbers with decimal
1384points are allowed in front of an exponent. Then exponents, like the
1385overall sign, are independent of whether we are matching numbers with
1386or without decimal points, and can be 'decoupled' from the
1387mantissa. The overall form of the regexp now becomes clear:
1388
1389 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1390
1391The exponent is an C<e> or C<E>, followed by an integer. So the
1392exponent regexp is
1393
1394 /[eE][+-]?\d+/; # exponent
1395
1396Putting all the parts together, we get a regexp that matches numbers:
1397
1398 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1399
1400Long regexps like this may impress your friends, but can be hard to
1401decipher. In complex situations like this, the C<//x> modifier for a
1402match is invaluable. It allows one to put nearly arbitrary whitespace
1403and comments into a regexp without affecting their meaning. Using it,
1404we can rewrite our 'extended' regexp in the more pleasing form
1405
1406 /^
1407 [+-]? # first, match an optional sign
1408 ( # then match integers or f.p. mantissas:
1409 \d+\.\d+ # mantissa of the form a.b
1410 |\d+\. # mantissa of the form a.
1411 |\.\d+ # mantissa of the form .b
1412 |\d+ # integer of the form a
1413 )
1414 ([eE][+-]?\d+)? # finally, optionally match an exponent
1415 $/x;
1416
1417If whitespace is mostly irrelevant, how does one include space
1418characters in an extended regexp? The answer is to backslash it
7638d2dc 1419S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing
47f9c88b 1420goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
7638d2dc 1421a space between the sign and the mantissa or integer, and we could add
47f9c88b
GS
1422this to our regexp as follows:
1423
1424 /^
1425 [+-]?\ * # first, match an optional sign *and space*
1426 ( # then match integers or f.p. mantissas:
1427 \d+\.\d+ # mantissa of the form a.b
1428 |\d+\. # mantissa of the form a.
1429 |\.\d+ # mantissa of the form .b
1430 |\d+ # integer of the form a
1431 )
1432 ([eE][+-]?\d+)? # finally, optionally match an exponent
1433 $/x;
1434
1435In this form, it is easier to see a way to simplify the
1436alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1437could be factored out:
1438
1439 /^
1440 [+-]?\ * # first, match an optional sign
1441 ( # then match integers or f.p. mantissas:
1442 \d+ # start out with a ...
1443 (
1444 \.\d* # mantissa of the form a.b or a.
1445 )? # ? takes care of integers of the form a
1446 |\.\d+ # mantissa of the form .b
1447 )
1448 ([eE][+-]?\d+)? # finally, optionally match an exponent
1449 $/x;
1450
1451or written in the compact form,
1452
1453 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1454
1455This is our final regexp. To recap, we built a regexp by
1456
1457=over 4
1458
551e1d92
RB
1459=item *
1460
1461specifying the task in detail,
47f9c88b 1462
551e1d92
RB
1463=item *
1464
1465breaking down the problem into smaller parts,
1466
1467=item *
47f9c88b 1468
551e1d92 1469translating the small parts into regexps,
47f9c88b 1470
551e1d92
RB
1471=item *
1472
1473combining the regexps,
1474
1475=item *
47f9c88b 1476
551e1d92 1477and optimizing the final combined regexp.
47f9c88b
GS
1478
1479=back
1480
1481These are also the typical steps involved in writing a computer
1482program. This makes perfect sense, because regular expressions are
7638d2dc 1483essentially programs written in a little computer language that specifies
47f9c88b
GS
1484patterns.
1485
1486=head2 Using regular expressions in Perl
1487
1488The last topic of Part 1 briefly covers how regexps are used in Perl
1489programs. Where do they fit into Perl syntax?
1490
1491We have already introduced the matching operator in its default
1492C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1493the binding operator C<=~> and its negation C<!~> to test for string
1494matches. Associated with the matching operator, we have discussed the
1495single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
353c6505
DL
1496extended C<//x> modifiers. There are a few more things you might
1497want to know about matching operators.
47f9c88b 1498
7638d2dc
WL
1499=head3 Optimizing pattern evaluation
1500
353c6505 1501We pointed out earlier that variables in regexps are substituted
7638d2dc 1502before the regexp is evaluated:
47f9c88b
GS
1503
1504 $pattern = 'Seuss';
1505 while (<>) {
1506 print if /$pattern/;
1507 }
1508
1509This will print any lines containing the word C<Seuss>. It is not as
7638d2dc
WL
1510efficient as it could be, however, because Perl has to re-evaluate
1511(or compile) C<$pattern> each time through the loop. If C<$pattern> won't be
47f9c88b 1512changing over the lifetime of the script, we can add the C<//o>
7638d2dc 1513modifier, which directs Perl to only perform variable substitutions
47f9c88b
GS
1514once:
1515
1516 #!/usr/bin/perl
1517 # Improved simple_grep
1518 $regexp = shift;
1519 while (<>) {
1520 print if /$regexp/o; # a good deal faster
1521 }
1522
7638d2dc
WL
1523
1524=head3 Prohibiting substitution
1525
1526If you change C<$pattern> after the first substitution happens, Perl
47f9c88b
GS
1527will ignore it. If you don't want any substitutions at all, use the
1528special delimiter C<m''>:
1529
16e8b840 1530 @pattern = ('Seuss');
47f9c88b 1531 while (<>) {
16e8b840 1532 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
47f9c88b
GS
1533 }
1534
353c6505 1535Similar to strings, C<m''> acts like apostrophes on a regexp; all other
7638d2dc 1536C<m> delimiters act like quotes. If the regexp evaluates to the empty string,
47f9c88b
GS
1537the regexp in the I<last successful match> is used instead. So we have
1538
1539 "dog" =~ /d/; # 'd' matches
1540 "dogbert =~ //; # this matches the 'd' regexp used before
1541
7638d2dc
WL
1542
1543=head3 Global matching
1544
47f9c88b 1545The final two modifiers C<//g> and C<//c> concern multiple matches.
da75cd15 1546The modifier C<//g> stands for global matching and allows the
47f9c88b
GS
1547matching operator to match within a string as many times as possible.
1548In scalar context, successive invocations against a string will have
1549`C<//g> jump from match to match, keeping track of position in the
1550string as it goes along. You can get or set the position with the
1551C<pos()> function.
1552
1553The use of C<//g> is shown in the following example. Suppose we have
1554a string that consists of words separated by spaces. If we know how
1555many words there are in advance, we could extract the words using
1556groupings:
1557
1558 $x = "cat dog house"; # 3 words
1559 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1560 # $1 = 'cat'
1561 # $2 = 'dog'
1562 # $3 = 'house'
1563
1564But what if we had an indeterminate number of words? This is the sort
1565of task C<//g> was made for. To extract all words, form the simple
1566regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1567
1568 while ($x =~ /(\w+)/g) {
1569 print "Word is $1, ends at position ", pos $x, "\n";
1570 }
1571
1572prints
1573
1574 Word is cat, ends at position 3
1575 Word is dog, ends at position 7
1576 Word is house, ends at position 13
1577
1578A failed match or changing the target string resets the position. If
1579you don't want the position reset after failure to match, add the
1580C<//c>, as in C</regexp/gc>. The current position in the string is
1581associated with the string, not the regexp. This means that different
1582strings have different positions and their respective positions can be
1583set or read independently.
1584
1585In list context, C<//g> returns a list of matched groupings, or if
1586there are no groupings, a list of matches to the whole regexp. So if
1587we wanted just the words, we could use
1588
1589 @words = ($x =~ /(\w+)/g); # matches,
1590 # $word[0] = 'cat'
1591 # $word[1] = 'dog'
1592 # $word[2] = 'house'
1593
1594Closely associated with the C<//g> modifier is the C<\G> anchor. The
1595C<\G> anchor matches at the point where the previous C<//g> match left
1596off. C<\G> allows us to easily do context-sensitive matching:
1597
1598 $metric = 1; # use metric units
1599 ...
1600 $x = <FILE>; # read in measurement
1601 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1602 $weight = $1;
1603 if ($metric) { # error checking
1604 print "Units error!" unless $x =~ /\Gkg\./g;
1605 }
1606 else {
1607 print "Units error!" unless $x =~ /\Glbs\./g;
1608 }
1609 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1610
1611The combination of C<//g> and C<\G> allows us to process the string a
1612bit at a time and use arbitrary Perl logic to decide what to do next.
25cf8c22
HS
1613Currently, the C<\G> anchor is only fully supported when used to anchor
1614to the start of the pattern.
47f9c88b
GS
1615
1616C<\G> is also invaluable in processing fixed length records with
1617regexps. Suppose we have a snippet of coding region DNA, encoded as
1618base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1619codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1620we can think of the DNA snippet as a sequence of 3-letter records. The
1621naive regexp
1622
1623 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1624 $dna = "ATCGTTGAATGCAAATGACATGAC";
1625 $dna =~ /TGA/;
1626
d1be9408 1627doesn't work; it may match a C<TGA>, but there is no guarantee that
47f9c88b 1628the match is aligned with codon boundaries, e.g., the substring
7638d2dc 1629S<C<GTT GAA>> gives a match. A better solution is
47f9c88b
GS
1630
1631 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1632 print "Got a TGA stop codon at position ", pos $dna, "\n";
1633 }
1634
1635which prints
1636
1637 Got a TGA stop codon at position 18
1638 Got a TGA stop codon at position 23
1639
1640Position 18 is good, but position 23 is bogus. What happened?
1641
1642The answer is that our regexp works well until we get past the last
1643real match. Then the regexp will fail to match a synchronized C<TGA>
1644and start stepping ahead one character position at a time, not what we
1645want. The solution is to use C<\G> to anchor the match to the codon
1646alignment:
1647
1648 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1649 print "Got a TGA stop codon at position ", pos $dna, "\n";
1650 }
1651
1652This prints
1653
1654 Got a TGA stop codon at position 18
1655
1656which is the correct answer. This example illustrates that it is
1657important not only to match what is desired, but to reject what is not
1658desired.
1659
7638d2dc 1660=head3 Search and replace
47f9c88b 1661
7638d2dc 1662Regular expressions also play a big role in I<search and replace>
47f9c88b
GS
1663operations in Perl. Search and replace is accomplished with the
1664C<s///> operator. The general form is
1665C<s/regexp/replacement/modifiers>, with everything we know about
1666regexps and modifiers applying in this case as well. The
1667C<replacement> is a Perl double quoted string that replaces in the
1668string whatever is matched with the C<regexp>. The operator C<=~> is
1669also used here to associate a string with C<s///>. If matching
7638d2dc 1670against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match,
47f9c88b
GS
1671C<s///> returns the number of substitutions made, otherwise it returns
1672false. Here are a few examples:
1673
1674 $x = "Time to feed the cat!";
1675 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1676 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1677 $more_insistent = 1;
1678 }
1679 $y = "'quoted words'";
1680 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1681 # $y contains "quoted words"
1682
1683In the last example, the whole string was matched, but only the part
1684inside the single quotes was grouped. With the C<s///> operator, the
1685matched variables C<$1>, C<$2>, etc. are immediately available for use
1686in the replacement expression, so we use C<$1> to replace the quoted
1687string with just what was quoted. With the global modifier, C<s///g>
1688will search and replace all occurrences of the regexp in the string:
1689
1690 $x = "I batted 4 for 4";
1691 $x =~ s/4/four/; # doesn't do it all:
1692 # $x contains "I batted four for 4"
1693 $x = "I batted 4 for 4";
1694 $x =~ s/4/four/g; # does it all:
1695 # $x contains "I batted four for four"
1696
1697If you prefer 'regex' over 'regexp' in this tutorial, you could use
1698the following program to replace it:
1699
1700 % cat > simple_replace
1701 #!/usr/bin/perl
1702 $regexp = shift;
1703 $replacement = shift;
1704 while (<>) {
1705 s/$regexp/$replacement/go;
1706 print;
1707 }
1708 ^D
1709
1710 % simple_replace regexp regex perlretut.pod
1711
1712In C<simple_replace> we used the C<s///g> modifier to replace all
1713occurrences of the regexp on each line and the C<s///o> modifier to
1714compile the regexp only once. As with C<simple_grep>, both the
1715C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1716
1717A modifier available specifically to search and replace is the
1718C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1719the replacement string and the evaluated result is substituted for the
1720matched substring. C<s///e> is useful if you need to do a bit of
1721computation in the process of replacing text. This example counts
1722character frequencies in a line:
1723
1724 $x = "Bill the cat";
1725 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1726 print "frequency of '$_' is $chars{$_}\n"
1727 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1728
1729This prints
1730
1731 frequency of ' ' is 2
1732 frequency of 't' is 2
1733 frequency of 'l' is 2
1734 frequency of 'B' is 1
1735 frequency of 'c' is 1
1736 frequency of 'e' is 1
1737 frequency of 'h' is 1
1738 frequency of 'i' is 1
1739 frequency of 'a' is 1
1740
1741As with the match C<m//> operator, C<s///> can use other delimiters,
1742such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1743used C<s'''>, then the regexp and replacement are treated as single
1744quoted strings and there are no substitutions. C<s///> in list context
1745returns the same thing as in scalar context, i.e., the number of
1746matches.
1747
7638d2dc 1748=head3 The split function
47f9c88b 1749
7638d2dc 1750The C<split()> function is another place where a regexp is used.
353c6505
DL
1751C<split /regexp/, string, limit> separates the C<string> operand into
1752a list of substrings and returns that list. The regexp must be designed
7638d2dc 1753to match whatever constitutes the separators for the desired substrings.
353c6505 1754The C<limit>, if present, constrains splitting into no more than C<limit>
7638d2dc 1755number of strings. For example, to split a string into words, use
47f9c88b
GS
1756
1757 $x = "Calvin and Hobbes";
1758 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1759 # $word[1] = 'and'
1760 # $word[2] = 'Hobbes'
1761
1762If the empty regexp C<//> is used, the regexp always matches and
1763the string is split into individual characters. If the regexp has
7638d2dc 1764groupings, then the resulting list contains the matched substrings from the
47f9c88b
GS
1765groupings as well. For instance,
1766
1767 $x = "/usr/bin/perl";
1768 @dirs = split m!/!, $x; # $dirs[0] = ''
1769 # $dirs[1] = 'usr'
1770 # $dirs[2] = 'bin'
1771 # $dirs[3] = 'perl'
1772 @parts = split m!(/)!, $x; # $parts[0] = ''
1773 # $parts[1] = '/'
1774 # $parts[2] = 'usr'
1775 # $parts[3] = '/'
1776 # $parts[4] = 'bin'
1777 # $parts[5] = '/'
1778 # $parts[6] = 'perl'
1779
1780Since the first character of $x matched the regexp, C<split> prepended
1781an empty initial element to the list.
1782
1783If you have read this far, congratulations! You now have all the basic
1784tools needed to use regular expressions to solve a wide range of text
1785processing problems. If this is your first time through the tutorial,
1786why not stop here and play around with regexps a while... S<Part 2>
1787concerns the more esoteric aspects of regular expressions and those
1788concepts certainly aren't needed right at the start.
1789
1790=head1 Part 2: Power tools
1791
1792OK, you know the basics of regexps and you want to know more. If
1793matching regular expressions is analogous to a walk in the woods, then
1794the tools discussed in Part 1 are analogous to topo maps and a
1795compass, basic tools we use all the time. Most of the tools in part 2
da75cd15 1796are analogous to flare guns and satellite phones. They aren't used
47f9c88b
GS
1797too often on a hike, but when we are stuck, they can be invaluable.
1798
1799What follows are the more advanced, less used, or sometimes esoteric
7638d2dc 1800capabilities of Perl regexps. In Part 2, we will assume you are
47f9c88b
GS
1801comfortable with the basics and concentrate on the new features.
1802
1803=head2 More on characters, strings, and character classes
1804
1805There are a number of escape sequences and character classes that we
1806haven't covered yet.
1807
1808There are several escape sequences that convert characters or strings
7638d2dc 1809between upper and lower case, and they are also available within
353c6505 1810patterns. C<\l> and C<\u> convert the next character to lower or
7638d2dc 1811upper case, respectively:
47f9c88b
GS
1812
1813 $x = "perl";
1814 $string =~ /\u$x/; # matches 'Perl' in $string
1815 $x = "M(rs?|s)\\."; # note the double backslash
1816 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1817
7638d2dc
WL
1818A C<\L> or C<\U> indicates a lasting conversion of case, until
1819terminated by C<\E> or thrown over by another C<\U> or C<\L>:
47f9c88b
GS
1820
1821 $x = "This word is in lower case:\L SHOUT\E";
1822 $x =~ /shout/; # matches
1823 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1824 $x =~ /\Ukeypunch/; # matches punch card string
1825
1826If there is no C<\E>, case is converted until the end of the
1827string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1828character of C<$word> to uppercase and the rest of the characters to
1829lowercase.
1830
1831Control characters can be escaped with C<\c>, so that a control-Z
1832character would be matched with C<\cZ>. The escape sequence
1833C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1834instance,
1835
1836 $x = "\QThat !^*&%~& cat!";
1837 $x =~ /\Q!^*&%~&\E/; # check for rough language
1838
1839It does not protect C<$> or C<@>, so that variables can still be
1840substituted.
1841
7638d2dc
WL
1842With the advent of 5.6.0, Perl regexps can handle more than just the
1843standard ASCII character set. Perl now supports I<Unicode>, a standard
1844for representing the alphabets from virtually all of the world's written
38a44b82 1845languages, and a host of symbols. Perl's text strings are Unicode strings, so
2575c402
JW
1846they can contain characters with a value (codepoint or character number) higher
1847than 255
47f9c88b
GS
1848
1849What does this mean for regexps? Well, regexp users don't need to know
7638d2dc 1850much about Perl's internal representation of strings. But they do need
2575c402
JW
1851to know 1) how to represent Unicode characters in a regexp and 2) that
1852a matching operation will treat the string to be searched as a sequence
1853of characters, not bytes. The answer to 1) is that Unicode characters
1854greater than C<chr(255)> are represented using the C<\x{hex}> notation,
1855because the \0 octal and \x hex (without curly braces) don't go further
1856than 255.
47f9c88b 1857
47f9c88b
GS
1858 /\x{263a}/; # match a Unicode smiley face :)
1859
7638d2dc 1860B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use
72ff2908
JH
1861utf8> to use any Unicode features. This is no more the case: for
1862almost all Unicode processing, the explicit C<utf8> pragma is not
1863needed. (The only case where it matters is if your Perl script is in
1864Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
47f9c88b
GS
1865
1866Figuring out the hexadecimal sequence of a Unicode character you want
1867or deciphering someone else's hexadecimal Unicode regexp is about as
1868much fun as programming in machine code. So another way to specify
e526e8bb
KW
1869Unicode characters is to use the I<named character> escape
1870sequence C<\N{I<name>}>. I<name> is a name for the Unicode character, as
55eda711
JH
1871specified in the Unicode standard. For instance, if we wanted to
1872represent or match the astrological sign for the planet Mercury, we
1873could use
47f9c88b 1874
47f9c88b
GS
1875 use charnames ":full"; # use named chars with Unicode full names
1876 $x = "abc\N{MERCURY}def";
1877 $x =~ /\N{MERCURY}/; # matches
1878
1879One can also use short names or restrict names to a certain alphabet:
1880
47f9c88b
GS
1881 use charnames ':full';
1882 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1883
1884 use charnames ":short";
1885 print "\N{greek:Sigma} is an upper-case sigma.\n";
1886
1887 use charnames qw(greek);
1888 print "\N{sigma} is Greek sigma\n";
1889
7638d2dc
WL
1890A list of full names is found in the file NamesList.txt in the
1891lib/perl5/X.X.X/unicore directory (where X.X.X is the perl
1892version number as it is installed on your system).
47f9c88b 1893
38a44b82 1894The answer to requirement 2), as of 5.6.0, is that a regexp uses Unicode
2575c402
JW
1895characters. Internally, this is encoded to bytes using either UTF-8 or a
1896native 8 bit encoding, depending on the history of the string, but
1897conceptually it is a sequence of characters, not bytes. See
1898L<perlunitut> for a tutorial about that.
1899
1900Let us now discuss Unicode character classes. Just as with Unicode
1901characters, there are named Unicode character classes represented by the
1902C<\p{name}> escape sequence. Closely associated is the C<\P{name}>
1903character class, which is the negation of the C<\p{name}> class. For
1904example, to match lower and uppercase characters,
47f9c88b 1905
47f9c88b
GS
1906 use charnames ":full"; # use named chars with Unicode full names
1907 $x = "BOB";
1908 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1909 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1910 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1911 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1912
86929931
JH
1913Here is the association between some Perl named classes and the
1914traditional Unicode classes:
47f9c88b 1915
86929931 1916 Perl class name Unicode class name or regular expression
47f9c88b 1917
f5868911
JH
1918 IsAlpha /^[LM]/
1919 IsAlnum /^[LMN]/
1920 IsASCII $code <= 127
1921 IsCntrl /^C/
1922 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
47f9c88b 1923 IsDigit Nd
f5868911 1924 IsGraph /^([LMNPS]|Co)/
47f9c88b 1925 IsLower Ll
f5868911
JH
1926 IsPrint /^([LMNPS]|Co|Zs)/
1927 IsPunct /^P/
1928 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
08ce8fc6 1929 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
f5868911
JH
1930 IsUpper /^L[ut]/
1931 IsWord /^[LMN]/ || $code eq "005F"
47f9c88b
GS
1932 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1933
86929931
JH
1934You can also use the official Unicode class names with the C<\p> and
1935C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1936letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1937letter, the braces can be dropped. For instance, C<\pM> is the
98f22ffc 1938character class of Unicode 'marks', for example accent marks.
32293815
JH
1939For the full list see L<perlunicode>.
1940
fa11829f 1941The Unicode has also been separated into various sets of characters
7638d2dc
WL
1942which you can test with C<\p{...}> (in) and C<\P{...}> (not in).
1943To test whether a character is (or is not) an element of a script
353c6505 1944you would use the script name, for example C<\p{Latin}>, C<\p{Greek}>,
7638d2dc
WL
1945or C<\P{Katakana}>. Other sets are the Unicode blocks, the names
1946of which begin with "In". One such block is dedicated to mathematical
1947operators, and its pattern formula is <C\p{InMathematicalOperators>}>.
e1b711da
KW
1948For the full list see L<perluniprops>.
1949
1950What we have described so far is the single form of the C<\p{...}> character
1951classes. There is also a compound form which you may run into. These
1952look like C<\p{name=value}> or C<\p{name:value}> (the equals sign and colon
1953can be used interchangeably). These are more general than the single form,
1954and in fact most of the single forms are just Perl-defined shortcuts for common
1955compound forms. For example, the script examples in the previous paragraph
1956could be written equivalently as C<\p{Script=Latin}>, C<\p{Script:Greek}>, and
1957C<\P{script=katakana}> (case is irrelevant between the C<{}> braces). You may
1958never have to use the compound forms, but sometimes it is necessary, and their
1959use can make your code easier to understand.
47f9c88b 1960
7638d2dc 1961C<\X> is an abbreviation for a character class that comprises
e1b711da
KW
1962a Unicode I<extended grapheme cluster>. This represents a "logical character",
1963what appears to be a single character, but may be represented internally by more
1964than one. As an example, using the Unicode full names, e.g., S<C<A + COMBINING
1965RING>> is a grapheme cluster with base character C<A> and combining character
1966S<C<COMBINING RING>>, which translates in Danish to A with the circle atop it,
1967as in the word Angstrom.
47f9c88b 1968
da75cd15 1969For the full and latest information about Unicode see the latest
e1b711da 1970Unicode standard, or the Unicode Consortium's website L<http://www.unicode.org>
5e42d7b4 1971
47f9c88b
GS
1972As if all those classes weren't enough, Perl also defines POSIX style
1973character classes. These have the form C<[:name:]>, with C<name> the
aaa51d5e
JF
1974name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1975C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1976C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1977extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1978is being used, then these classes are defined the same as their
7638d2dc 1979corresponding Perl Unicode classes: C<[:upper:]> is the same as
aaa51d5e
JF
1980C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1981require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
47f9c88b 1982C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
aaa51d5e
JF
1983character classes. To negate a POSIX class, put a C<^> in front of
1984the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
47f9c88b 1985C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
54c18d04
MK
1986be used just like C<\d>, with the exception that POSIX character
1987classes can only be used inside of a character class:
47f9c88b
GS
1988
1989 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
54c18d04 1990 /^=item\s[[:digit:]]/; # match '=item',
47f9c88b 1991 # followed by a space and a digit
47f9c88b
GS
1992 use charnames ":full";
1993 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1994 /^=item\s\p{IsDigit}/; # match '=item',
1995 # followed by a space and a digit
1996
1997Whew! That is all the rest of the characters and character classes.
1998
1999=head2 Compiling and saving regular expressions
2000
2001In Part 1 we discussed the C<//o> modifier, which compiles a regexp
2002just once. This suggests that a compiled regexp is some data structure
2003that can be stored once and used again and again. The regexp quote
2004C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
2005regexp and transforms the result into a form that can be assigned to a
2006variable:
2007
2008 $reg = qr/foo+bar?/; # reg contains a compiled regexp
2009
2010Then C<$reg> can be used as a regexp:
2011
2012 $x = "fooooba";
2013 $x =~ $reg; # matches, just like /foo+bar?/
2014 $x =~ /$reg/; # same thing, alternate form
2015
2016C<$reg> can also be interpolated into a larger regexp:
2017
2018 $x =~ /(abc)?$reg/; # still matches
2019
2020As with the matching operator, the regexp quote can use different
7638d2dc
WL
2021delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes
2022as delimiters (C<qr''>) inhibit any interpolation.
47f9c88b
GS
2023
2024Pre-compiled regexps are useful for creating dynamic matches that
2025don't need to be recompiled each time they are encountered. Using
7638d2dc
WL
2026pre-compiled regexps, we write a C<grep_step> program which greps
2027for a sequence of patterns, advancing to the next pattern as soon
2028as one has been satisfied.
47f9c88b 2029
7638d2dc 2030 % cat > grep_step
47f9c88b 2031 #!/usr/bin/perl
7638d2dc 2032 # grep_step - match <number> regexps, one after the other
47f9c88b
GS
2033 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2034
2035 $number = shift;
2036 $regexp[$_] = shift foreach (0..$number-1);
2037 @compiled = map qr/$_/, @regexp;
2038 while ($line = <>) {
7638d2dc
WL
2039 if ($line =~ /$compiled[0]/) {
2040 print $line;
2041 shift @compiled;
2042 last unless @compiled;
47f9c88b
GS
2043 }
2044 }
2045 ^D
2046
7638d2dc
WL
2047 % grep_step 3 shift print last grep_step
2048 $number = shift;
2049 print $line;
2050 last unless @compiled;
47f9c88b
GS
2051
2052Storing pre-compiled regexps in an array C<@compiled> allows us to
2053simply loop through the regexps without any recompilation, thus gaining
2054flexibility without sacrificing speed.
2055
7638d2dc
WL
2056
2057=head2 Composing regular expressions at runtime
2058
2059Backtracking is more efficient than repeated tries with different regular
2060expressions. If there are several regular expressions and a match with
353c6505 2061any of them is acceptable, then it is possible to combine them into a set
7638d2dc 2062of alternatives. If the individual expressions are input data, this
353c6505
DL
2063can be done by programming a join operation. We'll exploit this idea in
2064an improved version of the C<simple_grep> program: a program that matches
7638d2dc
WL
2065multiple patterns:
2066
2067 % cat > multi_grep
2068 #!/usr/bin/perl
2069 # multi_grep - match any of <number> regexps
2070 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2071
2072 $number = shift;
2073 $regexp[$_] = shift foreach (0..$number-1);
2074 $pattern = join '|', @regexp;
2075
2076 while ($line = <>) {
2077 print $line if $line =~ /$pattern/o;
2078 }
2079 ^D
2080
2081 % multi_grep 2 shift for multi_grep
2082 $number = shift;
2083 $regexp[$_] = shift foreach (0..$number-1);
2084
2085Sometimes it is advantageous to construct a pattern from the I<input>
2086that is to be analyzed and use the permissible values on the left
2087hand side of the matching operations. As an example for this somewhat
353c6505 2088paradoxical situation, let's assume that our input contains a command
7638d2dc 2089verb which should match one out of a set of available command verbs,
353c6505 2090with the additional twist that commands may be abbreviated as long as
7638d2dc
WL
2091the given string is unique. The program below demonstrates the basic
2092algorithm.
2093
2094 % cat > keymatch
2095 #!/usr/bin/perl
2096 $kwds = 'copy compare list print';
2097 while( $command = <> ){
2098 $command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
2099 if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
92a24ac3 2100 print "command: '@matches'\n";
7638d2dc
WL
2101 } elsif( @matches == 0 ){
2102 print "no such command: '$command'\n";
2103 } else {
2104 print "not unique: '$command' (could be one of: @matches)\n";
2105 }
2106 }
2107 ^D
2108
2109 % keymatch
2110 li
2111 command: 'list'
2112 co
2113 not unique: 'co' (could be one of: copy compare)
2114 printer
2115 no such command: 'printer'
2116
2117Rather than trying to match the input against the keywords, we match the
2118combined set of keywords against the input. The pattern matching
353c6505
DL
2119operation S<C<$kwds =~ /\b($command\w*)/g>> does several things at the
2120same time. It makes sure that the given command begins where a keyword
2121begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It
2122tells us the number of matches (C<scalar @matches>) and all the keywords
7638d2dc 2123that were actually matched. You could hardly ask for more.
7638d2dc 2124
47f9c88b
GS
2125=head2 Embedding comments and modifiers in a regular expression
2126
2127Starting with this section, we will be discussing Perl's set of
7638d2dc 2128I<extended patterns>. These are extensions to the traditional regular
47f9c88b
GS
2129expression syntax that provide powerful new tools for pattern
2130matching. We have already seen extensions in the form of the minimal
2131matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
2132rest of the extensions below have the form C<(?char...)>, where the
2133C<char> is a character that determines the type of extension.
2134
2135The first extension is an embedded comment C<(?#text)>. This embeds a
2136comment into the regular expression without affecting its meaning. The
2137comment should not have any closing parentheses in the text. An
2138example is
2139
2140 /(?# Match an integer:)[+-]?\d+/;
2141
2142This style of commenting has been largely superseded by the raw,
2143freeform commenting that is allowed with the C<//x> modifier.
2144
24549070
PG
2145The modifiers C<//i>, C<//m>, C<//s> and C<//x> (or any
2146combination thereof) can also be embedded in
47f9c88b
GS
2147a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
2148
2149 /(?i)yes/; # match 'yes' case insensitively
2150 /yes/i; # same thing
2151 /(?x)( # freeform version of an integer regexp
2152 [+-]? # match an optional sign
2153 \d+ # match a sequence of digits
2154 )
2155 /x;
2156
2157Embedded modifiers can have two important advantages over the usual
2158modifiers. Embedded modifiers allow a custom set of modifiers to
2159I<each> regexp pattern. This is great for matching an array of regexps
2160that must have different modifiers:
2161
2162 $pattern[0] = '(?i)doctor';
2163 $pattern[1] = 'Johnson';
2164 ...
2165 while (<>) {
2166 foreach $patt (@pattern) {
2167 print if /$patt/;
2168 }
2169 }
2170
24549070 2171The second advantage is that embedded modifiers (except C<//p>, which
7638d2dc 2172modifies the entire regexp) only affect the regexp
47f9c88b
GS
2173inside the group the embedded modifier is contained in. So grouping
2174can be used to localize the modifier's effects:
2175
2176 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
2177
2178Embedded modifiers can also turn off any modifiers already present
2179by using, e.g., C<(?-i)>. Modifiers can also be combined into
2180a single expression, e.g., C<(?s-i)> turns on single line mode and
2181turns off case insensitivity.
2182
7638d2dc 2183Embedded modifiers may also be added to a non-capturing grouping.
47f9c88b
GS
2184C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
2185case insensitively and turns off multi-line mode.
2186
7638d2dc 2187
47f9c88b
GS
2188=head2 Looking ahead and looking behind
2189
2190This section concerns the lookahead and lookbehind assertions. First,
2191a little background.
2192
2193In Perl regular expressions, most regexp elements 'eat up' a certain
2194amount of string when they match. For instance, the regexp element
2195C<[abc}]> eats up one character of the string when it matches, in the
7638d2dc 2196sense that Perl moves to the next character position in the string
47f9c88b
GS
2197after the match. There are some elements, however, that don't eat up
2198characters (advance the character position) if they match. The examples
2199we have seen so far are the anchors. The anchor C<^> matches the
2200beginning of the line, but doesn't eat any characters. Similarly, the
7638d2dc 2201word boundary anchor C<\b> matches wherever a character matching C<\w>
353c6505 2202is next to a character that doesn't, but it doesn't eat up any
7638d2dc
WL
2203characters itself. Anchors are examples of I<zero-width assertions>.
2204Zero-width, because they consume
47f9c88b
GS
2205no characters, and assertions, because they test some property of the
2206string. In the context of our walk in the woods analogy to regexp
2207matching, most regexp elements move us along a trail, but anchors have
2208us stop a moment and check our surroundings. If the local environment
2209checks out, we can proceed forward. But if the local environment
2210doesn't satisfy us, we must backtrack.
2211
2212Checking the environment entails either looking ahead on the trail,
2213looking behind, or both. C<^> looks behind, to see that there are no
2214characters before. C<$> looks ahead, to see that there are no
2215characters after. C<\b> looks both ahead and behind, to see if the
7638d2dc 2216characters on either side differ in their "word-ness".
47f9c88b
GS
2217
2218The lookahead and lookbehind assertions are generalizations of the
2219anchor concept. Lookahead and lookbehind are zero-width assertions
2220that let us specify which characters we want to test for. The
2221lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
a6b2f353 2222assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
47f9c88b
GS
2223
2224 $x = "I catch the housecat 'Tom-cat' with catnip";
7638d2dc 2225 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
47f9c88b
GS
2226 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
2227 # $catwords[0] = 'catch'
2228 # $catwords[1] = 'catnip'
2229 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
2230 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
2231 # middle of $x
2232
a6b2f353 2233Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
47f9c88b
GS
2234non-capturing, since these are zero-width assertions. Thus in the
2235second regexp, the substrings captured are those of the whole regexp
a6b2f353
GS
2236itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
2237lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
2238width, i.e., a fixed number of characters long. Thus
2239C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2240negated versions of the lookahead and lookbehind assertions are
2241denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2242They evaluate true if the regexps do I<not> match:
47f9c88b
GS
2243
2244 $x = "foobar";
2245 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2246 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2247 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2248
f14c76ed
RGS
2249The C<\C> is unsupported in lookbehind, because the already
2250treacherous definition of C<\C> would become even more so
2251when going backwards.
2252
7638d2dc
WL
2253Here is an example where a string containing blank-separated words,
2254numbers and single dashes is to be split into its components.
2255Using C</\s+/> alone won't work, because spaces are not required between
2256dashes, or a word or a dash. Additional places for a split are established
2257by looking ahead and behind:
47f9c88b 2258
7638d2dc
WL
2259 $str = "one two - --6-8";
2260 @toks = split / \s+ # a run of spaces
2261 | (?<=\S) (?=-) # any non-space followed by '-'
2262 | (?<=-) (?=\S) # a '-' followed by any non-space
2263 /x, $str; # @toks = qw(one two - - - 6 - 8)
47f9c88b 2264
7638d2dc
WL
2265
2266=head2 Using independent subexpressions to prevent backtracking
2267
2268I<Independent subexpressions> are regular expressions, in the
47f9c88b
GS
2269context of a larger regular expression, that function independently of
2270the larger regular expression. That is, they consume as much or as
2271little of the string as they wish without regard for the ability of
2272the larger regexp to match. Independent subexpressions are represented
2273by C<< (?>regexp) >>. We can illustrate their behavior by first
2274considering an ordinary regexp:
2275
2276 $x = "ab";
2277 $x =~ /a*ab/; # matches
2278
2279This obviously matches, but in the process of matching, the
2280subexpression C<a*> first grabbed the C<a>. Doing so, however,
2281wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2282eventually gave back the C<a> and matched the empty string. Here, what
2283C<a*> matched was I<dependent> on what the rest of the regexp matched.
2284
2285Contrast that with an independent subexpression:
2286
2287 $x =~ /(?>a*)ab/; # doesn't match!
2288
2289The independent subexpression C<< (?>a*) >> doesn't care about the rest
2290of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2291regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
da75cd15 2292is no backtracking and the independent subexpression does not give
47f9c88b
GS
2293up its C<a>. Thus the match of the regexp as a whole fails. A similar
2294behavior occurs with completely independent regexps:
2295
2296 $x = "ab";
2297 $x =~ /a*/g; # matches, eats an 'a'
2298 $x =~ /\Gab/g; # doesn't match, no 'a' available
2299
2300Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2301one regexp to the other. Regexps with an independent subexpression are
2302much like this, with a handoff of the string to the independent
2303subexpression, and a handoff of the string back to the enclosing
2304regexp.
2305
2306The ability of an independent subexpression to prevent backtracking
2307can be quite useful. Suppose we want to match a non-empty string
2308enclosed in parentheses up to two levels deep. Then the following
2309regexp matches:
2310
2311 $x = "abc(de(fg)h"; # unbalanced parentheses
2312 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2313
2314The regexp matches an open parenthesis, one or more copies of an
2315alternation, and a close parenthesis. The alternation is two-way, with
2316the first alternative C<[^()]+> matching a substring with no
2317parentheses and the second alternative C<\([^()]*\)> matching a
2318substring delimited by parentheses. The problem with this regexp is
2319that it is pathological: it has nested indeterminate quantifiers
07698885 2320of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
47f9c88b
GS
2321like this could take an exponentially long time to execute if there
2322was no match possible. To prevent the exponential blowup, we need to
2323prevent useless backtracking at some point. This can be done by
2324enclosing the inner quantifier as an independent subexpression:
2325
2326 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2327
2328Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2329by gobbling up as much of the string as possible and keeping it. Then
2330match failures fail much more quickly.
2331
7638d2dc 2332
47f9c88b
GS
2333=head2 Conditional expressions
2334
7638d2dc 2335A I<conditional expression> is a form of if-then-else statement
47f9c88b
GS
2336that allows one to choose which patterns are to be matched, based on
2337some condition. There are two types of conditional expression:
2338C<(?(condition)yes-regexp)> and
2339C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
7638d2dc 2340like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true,
47f9c88b 2341the C<yes-regexp> will be matched. If the C<condition> is false, the
7638d2dc
WL
2342C<yes-regexp> will be skipped and Perl will move onto the next regexp
2343element. The second form is like an S<C<'if () {} else {}'>> statement
47f9c88b
GS
2344in Perl. If the C<condition> is true, the C<yes-regexp> will be
2345matched, otherwise the C<no-regexp> will be matched.
2346
7638d2dc 2347The C<condition> can have several forms. The first form is simply an
47f9c88b 2348integer in parentheses C<(integer)>. It is true if the corresponding
7638d2dc
WL
2349backreference C<\integer> matched earlier in the regexp. The same
2350thing can be done with a name associated with a capture buffer, written
2351as C<< (<name>) >> or C<< ('name') >>. The second form is a bare
353c6505 2352zero width assertion C<(?...)>, either a lookahead, a lookbehind, or a
7638d2dc
WL
2353code assertion (discussed in the next section). The third set of forms
2354provides tests that return true if the expression is executed within
2355a recursion (C<(R)>) or is being called from some capturing group,
2356referenced either by number (C<(R1)>, C<(R2)>,...) or by name
2357(C<(R&name)>).
2358
2359The integer or name form of the C<condition> allows us to choose,
2360with more flexibility, what to match based on what matched earlier in the
2361regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">:
47f9c88b
GS
2362
2363 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2364 beriberi
2365 coco
2366 couscous
2367 deed
2368 ...
2369 toot
2370 toto
2371 tutu
2372
2373The lookbehind C<condition> allows, along with backreferences,
2374an earlier part of the match to influence a later part of the
2375match. For instance,
2376
2377 /[ATGC]+(?(?<=AA)G|C)$/;
2378
2379matches a DNA sequence such that it either ends in C<AAG>, or some
2380other base pair combination and C<C>. Note that the form is
a6b2f353
GS
2381C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2382lookahead, lookbehind or code assertions, the parentheses around the
2383conditional are not needed.
47f9c88b 2384
7638d2dc
WL
2385
2386=head2 Defining named patterns
2387
2388Some regular expressions use identical subpatterns in several places.
2389Starting with Perl 5.10, it is possible to define named subpatterns in
2390a section of the pattern so that they can be called up by name
2391anywhere in the pattern. This syntactic pattern for this definition
2392group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion
2393of a named pattern is written as C<(?&name)>.
2394
2395The example below illustrates this feature using the pattern for
2396floating point numbers that was presented earlier on. The three
2397subpatterns that are used more than once are the optional sign, the
2398digit sequence for an integer and the decimal fraction. The DEFINE
2399group at the end of the pattern contains their definition. Notice
2400that the decimal fraction pattern is the first place where we can
2401reuse the integer pattern.
2402
353c6505 2403 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
7638d2dc
WL
2404 (?: [eE](?&osg)(?&int) )?
2405 $
2406 (?(DEFINE)
2407 (?<osg>[-+]?) # optional sign
2408 (?<int>\d++) # integer
2409 (?<dec>\.(?&int)) # decimal fraction
2410 )/x
2411
2412
2413=head2 Recursive patterns
2414
2415This feature (introduced in Perl 5.10) significantly extends the
2416power of Perl's pattern matching. By referring to some other
2417capture group anywhere in the pattern with the construct
353c6505 2418C<(?group-ref)>, the I<pattern> within the referenced group is used
7638d2dc
WL
2419as an independent subpattern in place of the group reference itself.
2420Because the group reference may be contained I<within> the group it
2421refers to, it is now possible to apply pattern matching to tasks that
2422hitherto required a recursive parser.
2423
2424To illustrate this feature, we'll design a pattern that matches if
2425a string contains a palindrome. (This is a word or a sentence that,
2426while ignoring spaces, interpunctuation and case, reads the same backwards
2427as forwards. We begin by observing that the empty string or a string
2428containing just one word character is a palindrome. Otherwise it must
2429have a word character up front and the same at its end, with another
2430palindrome in between.
2431
fd2b7f55 2432 /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
7638d2dc 2433
e57a4e52 2434Adding C<\W*> at either end to eliminate what is to be ignored, we already
7638d2dc
WL
2435have the full pattern:
2436
2437 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
2438 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
2439 print "'$s' is a palindrome\n" if $s =~ /$pp/;
2440 }
2441
2442In C<(?...)> both absolute and relative backreferences may be used.
2443The entire pattern can be reinserted with C<(?R)> or C<(?0)>.
2444If you prefer to name your buffers, you can use C<(?&name)> to
2445recurse into that buffer.
2446
2447
47f9c88b
GS
2448=head2 A bit of magic: executing Perl code in a regular expression
2449
2450Normally, regexps are a part of Perl expressions.
7638d2dc 2451I<Code evaluation> expressions turn that around by allowing
da75cd15 2452arbitrary Perl code to be a part of a regexp. A code evaluation
7638d2dc 2453expression is denoted C<(?{code})>, with I<code> a string of Perl
47f9c88b
GS
2454statements.
2455
353c6505 2456Be warned that this feature is considered experimental, and may be
7638d2dc
WL
2457changed without notice.
2458
47f9c88b
GS
2459Code expressions are zero-width assertions, and the value they return
2460depends on their environment. There are two possibilities: either the
2461code expression is used as a conditional in a conditional expression
2462C<(?(condition)...)>, or it is not. If the code expression is a
2463conditional, the code is evaluated and the result (i.e., the result of
2464the last statement) is used to determine truth or falsehood. If the
2465code expression is not used as a conditional, the assertion always
2466evaluates true and the result is put into the special variable
2467C<$^R>. The variable C<$^R> can then be used in code expressions later
2468in the regexp. Here are some silly examples:
2469
2470 $x = "abcdef";
2471 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2472 # prints 'Hi Mom!'
2473 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2474 # no 'Hi Mom!'
745e1e41
DC
2475
2476Pay careful attention to the next example:
2477
47f9c88b
GS
2478 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2479 # no 'Hi Mom!'
745e1e41
DC
2480 # but why not?
2481
2482At first glance, you'd think that it shouldn't print, because obviously
2483the C<ddd> isn't going to match the target string. But look at this
2484example:
2485
87167316
RGS
2486 $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
2487 # but _does_ print
745e1e41
DC
2488
2489Hmm. What happened here? If you've been following along, you know that
ac036724 2490the above pattern should be effectively (almost) the same as the last one;
2491enclosing the C<d> in a character class isn't going to change what it
745e1e41
DC
2492matches. So why does the first not print while the second one does?
2493
7638d2dc 2494The answer lies in the optimizations the regex engine makes. In the first
745e1e41
DC
2495case, all the engine sees are plain old characters (aside from the
2496C<?{}> construct). It's smart enough to realize that the string 'ddd'
2497doesn't occur in our target string before actually running the pattern
2498through. But in the second case, we've tricked it into thinking that our
87167316 2499pattern is more complicated. It takes a look, sees our
745e1e41
DC
2500character class, and decides that it will have to actually run the
2501pattern to determine whether or not it matches, and in the process of
2502running it hits the print statement before it discovers that we don't
2503have a match.
2504
2505To take a closer look at how the engine does optimizations, see the
2506section L<"Pragmas and debugging"> below.
2507
2508More fun with C<?{}>:
2509
47f9c88b
GS
2510 $x =~ /(?{print "Hi Mom!";})/; # matches,
2511 # prints 'Hi Mom!'
2512 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2513 # prints '1'
2514 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2515 # prints '1'
2516
2517The bit of magic mentioned in the section title occurs when the regexp
2518backtracks in the process of searching for a match. If the regexp
2519backtracks over a code expression and if the variables used within are
2520localized using C<local>, the changes in the variables produced by the
2521code expression are undone! Thus, if we wanted to count how many times
2522a character got matched inside a group, we could use, e.g.,
2523
2524 $x = "aaaa";
2525 $count = 0; # initialize 'a' count
2526 $c = "bob"; # test if $c gets clobbered
2527 $x =~ /(?{local $c = 0;}) # initialize count
2528 ( a # match 'a'
2529 (?{local $c = $c + 1;}) # increment count
2530 )* # do this any number of times,
2531 aa # but match 'aa' at the end
2532 (?{$count = $c;}) # copy local $c var into $count
2533 /x;
2534 print "'a' count is $count, \$c variable is '$c'\n";
2535
2536This prints
2537
2538 'a' count is 2, $c variable is 'bob'
2539
7638d2dc
WL
2540If we replace the S<C< (?{local $c = $c + 1;})>> with
2541S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone
47f9c88b
GS
2542during backtracking, and we get
2543
2544 'a' count is 4, $c variable is 'bob'
2545
2546Note that only localized variable changes are undone. Other side
2547effects of code expression execution are permanent. Thus
2548
2549 $x = "aaaa";
2550 $x =~ /(a(?{print "Yow\n";}))*aa/;
2551
2552produces
2553
2554 Yow
2555 Yow
2556 Yow
2557 Yow
2558
2559The result C<$^R> is automatically localized, so that it will behave
2560properly in the presence of backtracking.
2561
7638d2dc
WL
2562This example uses a code expression in a conditional to match a
2563definite article, either 'the' in English or 'der|die|das' in German:
47f9c88b 2564
47f9c88b
GS
2565 $lang = 'DE'; # use German
2566 ...
2567 $text = "das";
2568 print "matched\n"
2569 if $text =~ /(?(?{
2570 $lang eq 'EN'; # is the language English?
2571 })
2572 the | # if so, then match 'the'
7638d2dc 2573 (der|die|das) # else, match 'der|die|das'
47f9c88b
GS
2574 )
2575 /xi;
2576
2577Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2578C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2579code expression, we don't need the extra parentheses around the
2580conditional.
2581
7638d2dc 2582If you try to use code expressions with interpolating variables, Perl
a6b2f353
GS
2583may surprise you:
2584
2585 $bar = 5;
2586 $pat = '(?{ 1 })';
2587 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2588 /foo(?{ 1 })$bar/; # compile error!
2589 /foo${pat}bar/; # compile error!
2590
2591 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2592 /foo${pat}bar/; # compiles ok
2593
fa11829f 2594If a regexp has (1) code expressions and interpolating variables, or
7638d2dc 2595(2) a variable that interpolates a code expression, Perl treats the
a6b2f353
GS
2596regexp as an error. If the code expression is precompiled into a
2597variable, however, interpolating is ok. The question is, why is this
2598an error?
2599
2600The reason is that variable interpolation and code expressions
2601together pose a security risk. The combination is dangerous because
2602many programmers who write search engines often take user input and
2603plug it directly into a regexp:
47f9c88b
GS
2604
2605 $regexp = <>; # read user-supplied regexp
2606 $chomp $regexp; # get rid of possible newline
2607 $text =~ /$regexp/; # search $text for the $regexp
2608
a6b2f353
GS
2609If the C<$regexp> variable contains a code expression, the user could
2610then execute arbitrary Perl code. For instance, some joker could
7638d2dc
WL
2611search for S<C<system('rm -rf *');>> to erase your files. In this
2612sense, the combination of interpolation and code expressions I<taints>
47f9c88b 2613your regexp. So by default, using both interpolation and code
a6b2f353
GS
2614expressions in the same regexp is not allowed. If you're not
2615concerned about malicious users, it is possible to bypass this
7638d2dc 2616security check by invoking S<C<use re 'eval'>>:
a6b2f353
GS
2617
2618 use re 'eval'; # throw caution out the door
2619 $bar = 5;
2620 $pat = '(?{ 1 })';
2621 /foo(?{ 1 })$bar/; # compiles ok
2622 /foo${pat}bar/; # compiles ok
47f9c88b 2623
7638d2dc 2624Another form of code expression is the I<pattern code expression>.
47f9c88b
GS
2625The pattern code expression is like a regular code expression, except
2626that the result of the code evaluation is treated as a regular
2627expression and matched immediately. A simple example is
2628
2629 $length = 5;
2630 $char = 'a';
2631 $x = 'aaaaabb';
2632 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2633
2634
2635This final example contains both ordinary and pattern code
7638d2dc 2636expressions. It detects whether a binary string C<1101010010001...> has a
47f9c88b
GS
2637Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2638
47f9c88b 2639 $x = "1101010010001000001";
7638d2dc 2640 $z0 = ''; $z1 = '0'; # initial conditions
47f9c88b
GS
2641 print "It is a Fibonacci sequence\n"
2642 if $x =~ /^1 # match an initial '1'
7638d2dc
WL
2643 (?:
2644 ((??{ $z0 })) # match some '0'
2645 1 # and then a '1'
2646 (?{ $z0 = $z1; $z1 .= $^N; })
47f9c88b
GS
2647 )+ # repeat as needed
2648 $ # that is all there is
2649 /x;
7638d2dc 2650 printf "Largest sequence matched was %d\n", length($z1)-length($z0);
47f9c88b 2651
7638d2dc
WL
2652Remember that C<$^N> is set to whatever was matched by the last
2653completed capture group. This prints
47f9c88b
GS
2654
2655 It is a Fibonacci sequence
2656 Largest sequence matched was 5
2657
2658Ha! Try that with your garden variety regexp package...
2659
7638d2dc 2660Note that the variables C<$z0> and C<$z1> are not substituted when the
47f9c88b 2661regexp is compiled, as happens for ordinary variables outside a code
7638d2dc 2662expression. Rather, the code expressions are evaluated when Perl
47f9c88b
GS
2663encounters them during the search for a match.
2664
2665The regexp without the C<//x> modifier is
2666
7638d2dc
WL
2667 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
2668
2669which shows that spaces are still possible in the code parts. Nevertheless,
353c6505 2670when working with code and conditional expressions, the extended form of
7638d2dc
WL
2671regexps is almost necessary in creating and debugging regexps.
2672
2673
2674=head2 Backtracking control verbs
2675
2676Perl 5.10 introduced a number of control verbs intended to provide
2677detailed control over the backtracking process, by directly influencing
2678the regexp engine and by providing monitoring techniques. As all
2679the features in this group are experimental and subject to change or
2680removal in a future version of Perl, the interested reader is
2681referred to L<perlre/"Special Backtracking Control Verbs"> for a
2682detailed description.
2683
2684Below is just one example, illustrating the control verb C<(*FAIL)>,
2685which may be abbreviated as C<(*F)>. If this is inserted in a regexp
2686it will cause to fail, just like at some mismatch between the pattern
2687and the string. Processing of the regexp continues like after any "normal"
353c6505
DL
2688failure, so that, for instance, the next position in the string or another
2689alternative will be tried. As failing to match doesn't preserve capture
2690buffers or produce results, it may be necessary to use this in
7638d2dc
WL
2691combination with embedded code.
2692
2693 %count = ();
2694 "supercalifragilisticexpialidoceous" =~
2695 /([aeiou])(?{ $count{$1}++; })(*FAIL)/oi;
2696 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
2697
353c6505
DL
2698The pattern begins with a class matching a subset of letters. Whenever
2699this matches, a statement like C<$count{'a'}++;> is executed, incrementing
2700the letter's counter. Then C<(*FAIL)> does what it says, and
2701the regexp engine proceeds according to the book: as long as the end of
2702the string hasn't been reached, the position is advanced before looking
7638d2dc 2703for another vowel. Thus, match or no match makes no difference, and the
e1020413 2704regexp engine proceeds until the entire string has been inspected.
7638d2dc
WL
2705(It's remarkable that an alternative solution using something like
2706
2707 $count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous");
2708 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
2709
2710is considerably slower.)
47f9c88b 2711
47f9c88b
GS
2712
2713=head2 Pragmas and debugging
2714
2715Speaking of debugging, there are several pragmas available to control
2716and debug regexps in Perl. We have already encountered one pragma in
7638d2dc 2717the previous section, S<C<use re 'eval';>>, that allows variable
a6b2f353
GS
2718interpolation and code expressions to coexist in a regexp. The other
2719pragmas are
47f9c88b
GS
2720
2721 use re 'taint';
2722 $tainted = <>;
2723 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2724
2725The C<taint> pragma causes any substrings from a match with a tainted
2726variable to be tainted as well. This is not normally the case, as
2727regexps are often used to extract the safe bits from a tainted
2728variable. Use C<taint> when you are not extracting safe bits, but are
2729performing some other processing. Both C<taint> and C<eval> pragmas
a6b2f353 2730are lexically scoped, which means they are in effect only until
47f9c88b
GS
2731the end of the block enclosing the pragmas.
2732
2733 use re 'debug';
2734 /^(.*)$/s; # output debugging info
2735
2736 use re 'debugcolor';
2737 /^(.*)$/s; # output debugging info in living color
2738
2739The global C<debug> and C<debugcolor> pragmas allow one to get
2740detailed debugging info about regexp compilation and
2741execution. C<debugcolor> is the same as debug, except the debugging
2742information is displayed in color on terminals that can display
2743termcap color sequences. Here is example output:
2744
2745 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2746 Compiling REx `a*b+c'
2747 size 9 first at 1
2748 1: STAR(4)
2749 2: EXACT <a>(0)
2750 4: PLUS(7)
2751 5: EXACT <b>(0)
2752 7: EXACT <c>(9)
2753 9: END(0)
2754 floating `bc' at 0..2147483647 (checking floating) minlen 2
2755 Guessing start of match, REx `a*b+c' against `abc'...
2756 Found floating substr `bc' at offset 1...
2757 Guessed: match at offset 0
2758 Matching REx `a*b+c' against `abc'
2759 Setting an EVAL scope, savestack=3
2760 0 <> <abc> | 1: STAR
2761 EXACT <a> can match 1 times out of 32767...
2762 Setting an EVAL scope, savestack=3
2763 1 <a> <bc> | 4: PLUS
2764 EXACT <b> can match 1 times out of 32767...
2765 Setting an EVAL scope, savestack=3
2766 2 <ab> <c> | 7: EXACT <c>
2767 3 <abc> <> | 9: END
2768 Match successful!
2769 Freeing REx: `a*b+c'
2770
2771If you have gotten this far into the tutorial, you can probably guess
2772what the different parts of the debugging output tell you. The first
2773part
2774
2775 Compiling REx `a*b+c'
2776 size 9 first at 1
2777 1: STAR(4)
2778 2: EXACT <a>(0)
2779 4: PLUS(7)
2780 5: EXACT <b>(0)
2781 7: EXACT <c>(9)
2782 9: END(0)
2783
2784describes the compilation stage. C<STAR(4)> means that there is a
2785starred object, in this case C<'a'>, and if it matches, goto line 4,
2786i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2787optimizations performed before a match:
2788
2789 floating `bc' at 0..2147483647 (checking floating) minlen 2
2790 Guessing start of match, REx `a*b+c' against `abc'...
2791 Found floating substr `bc' at offset 1...
2792 Guessed: match at offset 0
2793
2794Then the match is executed and the remaining lines describe the
2795process:
2796
2797 Matching REx `a*b+c' against `abc'
2798 Setting an EVAL scope, savestack=3
2799 0 <> <abc> | 1: STAR
2800 EXACT <a> can match 1 times out of 32767...
2801 Setting an EVAL scope, savestack=3
2802 1 <a> <bc> | 4: PLUS
2803 EXACT <b> can match 1 times out of 32767...
2804 Setting an EVAL scope, savestack=3
2805 2 <ab> <c> | 7: EXACT <c>
2806 3 <abc> <> | 9: END
2807 Match successful!
2808 Freeing REx: `a*b+c'
2809
7638d2dc 2810Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the
47f9c88b 2811part of the string matched and C<< <y> >> the part not yet
7638d2dc 2812matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1
47f9c88b
GS
2813n the compilation list above. See
2814L<perldebguts/"Debugging regular expressions"> for much more detail.
2815
2816An alternative method of debugging regexps is to embed C<print>
2817statements within the regexp. This provides a blow-by-blow account of
2818the backtracking in an alternation:
2819
2820 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2821 t(?{print "t1\n";})
2822 h(?{print "h1\n";})
2823 i(?{print "i1\n";})
2824 s(?{print "s1\n";})
2825 |
2826 t(?{print "t2\n";})
2827 h(?{print "h2\n";})
2828 a(?{print "a2\n";})
2829 t(?{print "t2\n";})
2830 (?{print "Done at position ", pos, "\n";})
2831 @x;
2832
2833prints
2834
2835 Start at position 0
2836 t1
2837 h1
2838 t2
2839 h2
2840 a2
2841 t2
2842 Done at position 4
2843
2844=head1 BUGS
2845
2846Code expressions, conditional expressions, and independent expressions
7638d2dc 2847are I<experimental>. Don't use them in production code. Yet.
47f9c88b
GS
2848
2849=head1 SEE ALSO
2850
7638d2dc 2851This is just a tutorial. For the full story on Perl regular
47f9c88b
GS
2852expressions, see the L<perlre> regular expressions reference page.
2853
2854For more information on the matching C<m//> and substitution C<s///>
2855operators, see L<perlop/"Regexp Quote-Like Operators">. For
2856information on the C<split> operation, see L<perlfunc/split>.
2857
2858For an excellent all-around resource on the care and feeding of
2859regular expressions, see the book I<Mastering Regular Expressions> by
2860Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2861
2862=head1 AUTHOR AND COPYRIGHT
2863
2864Copyright (c) 2000 Mark Kvale
2865All rights reserved.
2866
2867This document may be distributed under the same terms as Perl itself.
2868
2869=head2 Acknowledgments
2870
2871The inspiration for the stop codon DNA example came from the ZIP
2872code example in chapter 7 of I<Mastering Regular Expressions>.
2873
a6b2f353
GS
2874The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2875Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2876comments.
47f9c88b
GS
2877
2878=cut
a6b2f353 2879