This is a live mirror of the Perl 5 development currently hosted at https://github.com/perl/perl5
S_dopoptosub() is just a wrapper for S_dopoptosub_at(), so make it a
[perl5.git] / pod / perlretut.pod
CommitLineData
47f9c88b
GS
1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
44introduces the latest cutting edge innovations in 5.6.0.
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
7638d2dc 62What is this Perl statement all about? C<"Hello World"> is a simple
47f9c88b 63double quoted string. C<World> is the regular expression and the
7638d2dc 64C<//> enclosing C</World/> tells Perl to search a string for a match.
47f9c88b
GS
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
7638d2dc 79be reversed by using the C<!~> operator:
47f9c88b
GS
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
a6b2f353
GS
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
47f9c88b
GS
116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
7638d2dc
WL
118same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in this regexp
47f9c88b
GS
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
7638d2dc 131S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space
47f9c88b
GS
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
7638d2dc 140If a regexp matches in more than one place in the string, Perl will
47f9c88b
GS
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
7638d2dc 148is' in a match. Some characters, called I<metacharacters>, are reserved
47f9c88b
GS
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
7638d2dc 161 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
47f9c88b
GS
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
7638d2dc 168 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
47f9c88b
GS
169
170The backslash character C<'\'> is a metacharacter itself and needs to
171be backslashed:
172
173 'C:\WIN32' =~ /C:\\WIN/; # matches
174
175In addition to the metacharacters, there are some ASCII characters
176which don't have printable character equivalents and are instead
7638d2dc 177represented by I<escape sequences>. Common examples are C<\t> for a
47f9c88b
GS
178tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
179bell. If your string is better thought of as a sequence of arbitrary
180bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181sequence, e.g., C<\x1B> may be a more natural representation for your
182bytes. Here are some examples of escapes:
183
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
187 "cat" =~ /\143\x61\x74/ # matches, but a weird way to spell cat
188
189If you've been around Perl a while, all this talk of escape sequences
190may seem familiar. Similar escape sequences are used in double-quoted
191strings and in fact the regexps in Perl are mostly treated as
192double-quoted strings. This means that variables can be used in
193regexps as well. Just like double-quoted strings, the values of the
194variables in the regexp will be substituted in before the regexp is
195evaluated for matching purposes. So we have:
196
197 $foo = 'house';
198 'housecat' =~ /$foo/; # matches
199 'cathouse' =~ /cat$foo/; # matches
47f9c88b
GS
200 'housecat' =~ /${foo}cat/; # matches
201
202So far, so good. With the knowledge above you can already perform
203searches with just about any literal string regexp you can dream up.
204Here is a I<very simple> emulation of the Unix grep program:
205
206 % cat > simple_grep
207 #!/usr/bin/perl
208 $regexp = shift;
209 while (<>) {
210 print if /$regexp/;
211 }
212 ^D
213
214 % chmod +x simple_grep
215
216 % simple_grep abba /usr/dict/words
217 Babbage
218 cabbage
219 cabbages
220 sabbath
221 Sabbathize
222 Sabbathizes
223 sabbatical
224 scabbard
225 scabbards
226
227This program is easy to understand. C<#!/usr/bin/perl> is the standard
228way to invoke a perl program from the shell.
7638d2dc 229S<C<$regexp = shift;>> saves the first command line argument as the
47f9c88b 230regexp to be used, leaving the rest of the command line arguments to
7638d2dc
WL
231be treated as files. S<C<< while (<>) >>> loops over all the lines in
232all the files. For each line, S<C<print if /$regexp/;>> prints the
47f9c88b
GS
233line if the regexp matches the line. In this line, both C<print> and
234C</$regexp/> use the default variable C<$_> implicitly.
235
236With all of the regexps above, if the regexp matched anywhere in the
237string, it was considered a match. Sometimes, however, we'd like to
238specify I<where> in the string the regexp should try to match. To do
7638d2dc 239this, we would use the I<anchor> metacharacters C<^> and C<$>. The
47f9c88b
GS
240anchor C<^> means match at the beginning of the string and the anchor
241C<$> means match at the end of the string, or before a newline at the
242end of the string. Here is how they are used:
243
244 "housekeeper" =~ /keeper/; # matches
245 "housekeeper" =~ /^keeper/; # doesn't match
246 "housekeeper" =~ /keeper$/; # matches
247 "housekeeper\n" =~ /keeper$/; # matches
248
249The second regexp doesn't match because C<^> constrains C<keeper> to
250match only at the beginning of the string, but C<"housekeeper"> has
251keeper starting in the middle. The third regexp does match, since the
252C<$> constrains C<keeper> to match only at the end of the string.
253
254When both C<^> and C<$> are used at the same time, the regexp has to
255match both the beginning and the end of the string, i.e., the regexp
256matches the whole string. Consider
257
258 "keeper" =~ /^keep$/; # doesn't match
259 "keeper" =~ /^keeper$/; # matches
260 "" =~ /^$/; # ^$ matches an empty string
261
262The first regexp doesn't match because the string has more to it than
263C<keep>. Since the second regexp is exactly the string, it
264matches. Using both C<^> and C<$> in a regexp forces the complete
265string to match, so it gives you complete control over which strings
266match and which don't. Suppose you are looking for a fellow named
267bert, off in a string by himself:
268
269 "dogbert" =~ /bert/; # matches, but not what you want
270
271 "dilbert" =~ /^bert/; # doesn't match, but ..
272 "bertram" =~ /^bert/; # matches, so still not good enough
273
274 "bertram" =~ /^bert$/; # doesn't match, good
275 "dilbert" =~ /^bert$/; # doesn't match, good
276 "bert" =~ /^bert$/; # matches, perfect
277
278Of course, in the case of a literal string, one could just as easily
7638d2dc 279use the string comparison S<C<$string eq 'bert'>> and it would be
47f9c88b
GS
280more efficient. The C<^...$> regexp really becomes useful when we
281add in the more powerful regexp tools below.
282
283=head2 Using character classes
284
285Although one can already do quite a lot with the literal string
286regexps above, we've only scratched the surface of regular expression
287technology. In this and subsequent sections we will introduce regexp
288concepts (and associated metacharacter notations) that will allow a
289regexp to not just represent a single character sequence, but a I<whole
290class> of them.
291
7638d2dc 292One such concept is that of a I<character class>. A character class
47f9c88b
GS
293allows a set of possible characters, rather than just a single
294character, to match at a particular point in a regexp. Character
295classes are denoted by brackets C<[...]>, with the set of characters
296to be possibly matched inside. Here are some examples:
297
298 /cat/; # matches 'cat'
299 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
300 /item[0123456789]/; # matches 'item0' or ... or 'item9'
a6b2f353 301 "abc" =~ /[cab]/; # matches 'a'
47f9c88b
GS
302
303In the last statement, even though C<'c'> is the first character in
304the class, C<'a'> matches because the first character position in the
305string is the earliest point at which the regexp can match.
306
307 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
308 # 'yes', 'Yes', 'YES', etc.
309
da75cd15 310This regexp displays a common task: perform a case-insensitive
28c3722c 311match. Perl provides a way of avoiding all those brackets by simply
47f9c88b
GS
312appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
313can be rewritten as C</yes/i;>. The C<'i'> stands for
7638d2dc 314case-insensitive and is an example of a I<modifier> of the matching
47f9c88b
GS
315operation. We will meet other modifiers later in the tutorial.
316
317We saw in the section above that there were ordinary characters, which
318represented themselves, and special characters, which needed a
319backslash C<\> to represent themselves. The same is true in a
320character class, but the sets of ordinary and special characters
321inside a character class are different than those outside a character
7638d2dc
WL
322class. The special characters for a character class are C<-]\^$> (and
323the pattern delimiter, whatever it is).
324C<]> is special because it denotes the end of a character class. C<$> is
47f9c88b
GS
325special because it denotes a scalar variable. C<\> is special because
326it is used in escape sequences, just like above. Here is how the
327special characters C<]$\> are handled:
328
329 /[\]c]def/; # matches ']def' or 'cdef'
330 $x = 'bcr';
a6b2f353 331 /[$x]at/; # matches 'bat', 'cat', or 'rat'
47f9c88b
GS
332 /[\$x]at/; # matches '$at' or 'xat'
333 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
334
335The last two are a little tricky. in C<[\$x]>, the backslash protects
336the dollar sign, so the character class has two members C<$> and C<x>.
337In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
338variable and substituted in double quote fashion.
339
340The special character C<'-'> acts as a range operator within character
341classes, so that a contiguous set of characters can be written as a
342range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
343become the svelte C<[0-9]> and C<[a-z]>. Some examples are
344
345 /item[0-9]/; # matches 'item0' or ... or 'item9'
346 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
347 # 'baa', 'xaa', 'yaa', or 'zaa'
348 /[0-9a-fA-F]/; # matches a hexadecimal digit
36bbe248 349 /[0-9a-zA-Z_]/; # matches a "word" character,
7638d2dc 350 # like those in a Perl variable name
47f9c88b
GS
351
352If C<'-'> is the first or last character in a character class, it is
353treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
354all equivalent.
355
356The special character C<^> in the first position of a character class
7638d2dc 357denotes a I<negated character class>, which matches any character but
a6b2f353 358those in the brackets. Both C<[...]> and C<[^...]> must match a
47f9c88b
GS
359character, or the match fails. Then
360
361 /[^a]at/; # doesn't match 'aat' or 'at', but matches
362 # all other 'bat', 'cat, '0at', '%at', etc.
363 /[^0-9]/; # matches a non-numeric character
364 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
365
28c3722c 366Now, even C<[0-9]> can be a bother to write multiple times, so in the
47f9c88b 367interest of saving keystrokes and making regexps more readable, Perl
7638d2dc
WL
368has several abbreviations for common character classes, as shown below.
369Since the introduction of Unicode, these character classes match more
370than just a few characters in the ISO 8859-1 range.
47f9c88b
GS
371
372=over 4
373
374=item *
551e1d92 375
7638d2dc 376\d matches a digit, not just [0-9] but also digits from non-roman scripts
47f9c88b
GS
377
378=item *
551e1d92 379
7638d2dc 380\s matches a whitespace character, the set [\ \t\r\n\f] and others
47f9c88b
GS
381
382=item *
551e1d92 383
7638d2dc
WL
384\w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]
385but also digits and characters from non-roman scripts
47f9c88b
GS
386
387=item *
551e1d92 388
7638d2dc 389\D is a negated \d; it represents any other character than a digit, or [^\d]
47f9c88b
GS
390
391=item *
551e1d92 392
47f9c88b
GS
393\S is a negated \s; it represents any non-whitespace character [^\s]
394
395=item *
551e1d92 396
47f9c88b
GS
397\W is a negated \w; it represents any non-word character [^\w]
398
399=item *
551e1d92 400
7638d2dc
WL
401The period '.' matches any character but "\n" (unless the modifier C<//s> is
402in effect, as explained below).
47f9c88b
GS
403
404=back
405
406The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
407of character classes. Here are some in use:
408
409 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
410 /[\d\s]/; # matches any digit or whitespace character
411 /\w\W\w/; # matches a word char, followed by a
412 # non-word char, followed by a word char
413 /..rt/; # matches any two chars, followed by 'rt'
414 /end\./; # matches 'end.'
415 /end[.]/; # same thing, matches 'end.'
416
417Because a period is a metacharacter, it needs to be escaped to match
418as an ordinary period. Because, for example, C<\d> and C<\w> are sets
419of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
420fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
421C<[\W]>. Think DeMorgan's laws.
422
7638d2dc 423An anchor useful in basic regexps is the I<word anchor>
47f9c88b
GS
424C<\b>. This matches a boundary between a word character and a non-word
425character C<\w\W> or C<\W\w>:
426
427 $x = "Housecat catenates house and cat";
428 $x =~ /cat/; # matches cat in 'housecat'
429 $x =~ /\bcat/; # matches cat in 'catenates'
430 $x =~ /cat\b/; # matches cat in 'housecat'
431 $x =~ /\bcat\b/; # matches 'cat' at end of string
432
433Note in the last example, the end of the string is considered a word
434boundary.
435
436You might wonder why C<'.'> matches everything but C<"\n"> - why not
437every character? The reason is that often one is matching against
438lines and would like to ignore the newline characters. For instance,
439while the string C<"\n"> represents one line, we would like to think
28c3722c 440of it as empty. Then
47f9c88b
GS
441
442 "" =~ /^$/; # matches
7638d2dc 443 "\n" =~ /^$/; # matches, $ anchors before "\n"
47f9c88b
GS
444
445 "" =~ /./; # doesn't match; it needs a char
446 "" =~ /^.$/; # doesn't match; it needs a char
447 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
448 "a" =~ /^.$/; # matches
7638d2dc 449 "a\n" =~ /^.$/; # matches, $ anchors before "\n"
47f9c88b
GS
450
451This behavior is convenient, because we usually want to ignore
452newlines when we count and match characters in a line. Sometimes,
453however, we want to keep track of newlines. We might even want C<^>
454and C<$> to anchor at the beginning and end of lines within the
455string, rather than just the beginning and end of the string. Perl
456allows us to choose between ignoring and paying attention to newlines
457by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
458single line and multi-line and they determine whether a string is to
459be treated as one continuous string, or as a set of lines. The two
460modifiers affect two aspects of how the regexp is interpreted: 1) how
461the C<'.'> character class is defined, and 2) where the anchors C<^>
462and C<$> are able to match. Here are the four possible combinations:
463
464=over 4
465
466=item *
551e1d92 467
47f9c88b
GS
468no modifiers (//): Default behavior. C<'.'> matches any character
469except C<"\n">. C<^> matches only at the beginning of the string and
470C<$> matches only at the end or before a newline at the end.
471
472=item *
551e1d92 473
47f9c88b
GS
474s modifier (//s): Treat string as a single long line. C<'.'> matches
475any character, even C<"\n">. C<^> matches only at the beginning of
476the string and C<$> matches only at the end or before a newline at the
477end.
478
479=item *
551e1d92 480
47f9c88b
GS
481m modifier (//m): Treat string as a set of multiple lines. C<'.'>
482matches any character except C<"\n">. C<^> and C<$> are able to match
483at the start or end of I<any> line within the string.
484
485=item *
551e1d92 486
47f9c88b
GS
487both s and m modifiers (//sm): Treat string as a single long line, but
488detect multiple lines. C<'.'> matches any character, even
489C<"\n">. C<^> and C<$>, however, are able to match at the start or end
490of I<any> line within the string.
491
492=back
493
494Here are examples of C<//s> and C<//m> in action:
495
496 $x = "There once was a girl\nWho programmed in Perl\n";
497
498 $x =~ /^Who/; # doesn't match, "Who" not at start of string
499 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
500 $x =~ /^Who/m; # matches, "Who" at start of second line
501 $x =~ /^Who/sm; # matches, "Who" at start of second line
502
503 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
504 $x =~ /girl.Who/s; # matches, "." matches "\n"
505 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
506 $x =~ /girl.Who/sm; # matches, "." matches "\n"
507
3c12f9b9 508Most of the time, the default behavior is what is wanted, but C<//s> and
47f9c88b 509C<//m> are occasionally very useful. If C<//m> is being used, the start
28c3722c 510of the string can still be matched with C<\A> and the end of the string
47f9c88b
GS
511can still be matched with the anchors C<\Z> (matches both the end and
512the newline before, like C<$>), and C<\z> (matches only the end):
513
514 $x =~ /^Who/m; # matches, "Who" at start of second line
515 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
516
517 $x =~ /girl$/m; # matches, "girl" at end of first line
518 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
519
520 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
521 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
522
523We now know how to create choices among classes of characters in a
524regexp. What about choices among words or character strings? Such
525choices are described in the next section.
526
527=head2 Matching this or that
528
28c3722c 529Sometimes we would like our regexp to be able to match different
47f9c88b 530possible words or character strings. This is accomplished by using
7638d2dc
WL
531the I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
532form the regexp C<dog|cat>. As before, Perl will try to match the
47f9c88b 533regexp at the earliest possible point in the string. At each
7638d2dc
WL
534character position, Perl will first try to match the first
535alternative, C<dog>. If C<dog> doesn't match, Perl will then try the
47f9c88b 536next alternative, C<cat>. If C<cat> doesn't match either, then the
7638d2dc 537match fails and Perl moves to the next position in the string. Some
47f9c88b
GS
538examples:
539
540 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
541 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
542
543Even though C<dog> is the first alternative in the second regexp,
544C<cat> is able to match earlier in the string.
545
546 "cats" =~ /c|ca|cat|cats/; # matches "c"
547 "cats" =~ /cats|cat|ca|c/; # matches "cats"
548
549Here, all the alternatives match at the first string position, so the
550first alternative is the one that matches. If some of the
551alternatives are truncations of the others, put the longest ones first
552to give them a chance to match.
553
554 "cab" =~ /a|b|c/ # matches "c"
555 # /a|b|c/ == /[abc]/
556
557The last example points out that character classes are like
558alternations of characters. At a given character position, the first
210b36aa 559alternative that allows the regexp match to succeed will be the one
47f9c88b
GS
560that matches.
561
562=head2 Grouping things and hierarchical matching
563
564Alternation allows a regexp to choose among alternatives, but by
7638d2dc 565itself it is unsatisfying. The reason is that each alternative is a whole
47f9c88b
GS
566regexp, but sometime we want alternatives for just part of a
567regexp. For instance, suppose we want to search for housecats or
568housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
569inefficient because we had to type C<house> twice. It would be nice to
da75cd15 570have parts of the regexp be constant, like C<house>, and some
47f9c88b
GS
571parts have alternatives, like C<cat|keeper>.
572
7638d2dc 573The I<grouping> metacharacters C<()> solve this problem. Grouping
47f9c88b
GS
574allows parts of a regexp to be treated as a single unit. Parts of a
575regexp are grouped by enclosing them in parentheses. Thus we could solve
576the C<housecat|housekeeper> by forming the regexp as
577C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
578C<house> followed by either C<cat> or C<keeper>. Some more examples
579are
580
581 /(a|b)b/; # matches 'ab' or 'bb'
582 /(ac|b)b/; # matches 'acb' or 'bb'
583 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
584 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
585
586 /house(cat|)/; # matches either 'housecat' or 'house'
587 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
588 # 'house'. Note groups can be nested.
589
590 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
591 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
592 # because '20\d\d' can't match
593
594Alternations behave the same way in groups as out of them: at a given
595string position, the leftmost alternative that allows the regexp to
210b36aa 596match is taken. So in the last example at the first string position,
47f9c88b 597C<"20"> matches the second alternative, but there is nothing left over
7638d2dc 598to match the next two digits C<\d\d>. So Perl moves on to the next
47f9c88b
GS
599alternative, which is the null alternative and that works, since
600C<"20"> is two digits.
601
602The process of trying one alternative, seeing if it matches, and
7638d2dc
WL
603moving on to the next alternative, while going back in the string
604from where the previous alternative was tried, if it doesn't, is called
605I<backtracking>. The term 'backtracking' comes from the idea that
47f9c88b
GS
606matching a regexp is like a walk in the woods. Successfully matching
607a regexp is like arriving at a destination. There are many possible
608trailheads, one for each string position, and each one is tried in
609order, left to right. From each trailhead there may be many paths,
610some of which get you there, and some which are dead ends. When you
611walk along a trail and hit a dead end, you have to backtrack along the
612trail to an earlier point to try another trail. If you hit your
613destination, you stop immediately and forget about trying all the
614other trails. You are persistent, and only if you have tried all the
615trails from all the trailheads and not arrived at your destination, do
616you declare failure. To be concrete, here is a step-by-step analysis
7638d2dc 617of what Perl does when it tries to match the regexp
47f9c88b
GS
618
619 "abcde" =~ /(abd|abc)(df|d|de)/;
620
621=over 4
622
551e1d92
RB
623=item 0
624
625Start with the first letter in the string 'a'.
626
627=item 1
47f9c88b 628
551e1d92 629Try the first alternative in the first group 'abd'.
47f9c88b 630
551e1d92 631=item 2
47f9c88b 632
551e1d92
RB
633Match 'a' followed by 'b'. So far so good.
634
635=item 3
636
637'd' in the regexp doesn't match 'c' in the string - a dead
47f9c88b
GS
638end. So backtrack two characters and pick the second alternative in
639the first group 'abc'.
640
551e1d92
RB
641=item 4
642
643Match 'a' followed by 'b' followed by 'c'. We are on a roll
47f9c88b
GS
644and have satisfied the first group. Set $1 to 'abc'.
645
551e1d92
RB
646=item 5
647
648Move on to the second group and pick the first alternative
47f9c88b
GS
649'df'.
650
551e1d92 651=item 6
47f9c88b 652
551e1d92
RB
653Match the 'd'.
654
655=item 7
656
657'f' in the regexp doesn't match 'e' in the string, so a dead
47f9c88b
GS
658end. Backtrack one character and pick the second alternative in the
659second group 'd'.
660
551e1d92
RB
661=item 8
662
663'd' matches. The second grouping is satisfied, so set $2 to
47f9c88b
GS
664'd'.
665
551e1d92
RB
666=item 9
667
668We are at the end of the regexp, so we are done! We have
47f9c88b
GS
669matched 'abcd' out of the string "abcde".
670
671=back
672
673There are a couple of things to note about this analysis. First, the
674third alternative in the second group 'de' also allows a match, but we
675stopped before we got to it - at a given character position, leftmost
676wins. Second, we were able to get a match at the first character
677position of the string 'a'. If there were no matches at the first
7638d2dc 678position, Perl would move to the second character position 'b' and
47f9c88b 679attempt the match all over again. Only when all possible paths at all
7638d2dc
WL
680possible character positions have been exhausted does Perl give
681up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false.
47f9c88b
GS
682
683Even with all this work, regexp matching happens remarkably fast. To
7638d2dc
WL
684speed things up, Perl compiles the regexp into a compact sequence of
685opcodes that can often fit inside a processor cache. When the code is
686executed, these opcodes can then run at full throttle and search very
687quickly.
47f9c88b
GS
688
689=head2 Extracting matches
690
691The grouping metacharacters C<()> also serve another completely
692different function: they allow the extraction of the parts of a string
693that matched. This is very useful to find out what matched and for
694text processing in general. For each grouping, the part that matched
695inside goes into the special variables C<$1>, C<$2>, etc. They can be
696used just as ordinary variables:
697
698 # extract hours, minutes, seconds
2275acdc
RGS
699 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
700 $hours = $1;
701 $minutes = $2;
702 $seconds = $3;
703 }
47f9c88b
GS
704
705Now, we know that in scalar context,
7638d2dc 706S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false
47f9c88b
GS
707value. In list context, however, it returns the list of matched values
708C<($1,$2,$3)>. So we could write the code more compactly as
709
710 # extract hours, minutes, seconds
711 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
712
713If the groupings in a regexp are nested, C<$1> gets the group with the
714leftmost opening parenthesis, C<$2> the next opening parenthesis,
7638d2dc 715etc. Here is a regexp with nested groups:
47f9c88b
GS
716
717 /(ab(cd|ef)((gi)|j))/;
718 1 2 34
719
7638d2dc
WL
720If this regexp matches, C<$1> contains a string starting with
721C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either
722C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>,
723or it remains undefined.
724
725For convenience, Perl sets C<$+> to the string held by the highest numbered
726C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the
727value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>,
728C<$2>,... associated with the rightmost closing parenthesis used in the
a01268b5 729match).
47f9c88b 730
7638d2dc
WL
731
732=head2 Backreferences
733
47f9c88b 734Closely associated with the matching variables C<$1>, C<$2>, ... are
7638d2dc 735the I<backreferences> C<\1>, C<\2>,... Backreferences are simply
47f9c88b 736matching variables that can be used I<inside> a regexp. This is a
7638d2dc 737really nice feature -- what matches later in a regexp is made to depend on
47f9c88b 738what matched earlier in the regexp. Suppose we wanted to look
7638d2dc 739for doubled words in a text, like 'the the'. The following regexp finds
47f9c88b
GS
740all 3-letter doubles with a space in between:
741
7638d2dc 742 /\b(\w\w\w)\s\1\b/;
47f9c88b
GS
743
744The grouping assigns a value to \1, so that the same 3 letter sequence
7638d2dc
WL
745is used for both parts.
746
747A similar task is to find words consisting of two identical parts:
47f9c88b
GS
748
749 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
750 beriberi
751 booboo
752 coco
753 mama
754 murmur
755 papa
756
757The regexp has a single grouping which considers 4-letter
7638d2dc 758combinations, then 3-letter combinations, etc., and uses C<\1> to look for
47f9c88b 759a repeat. Although C<$1> and C<\1> represent the same thing, care should be
7638d2dc
WL
760taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp
761and backreferences C<\1>, C<\2>,... only I<inside> a regexp; not doing
762so may lead to surprising and unsatisfactory results.
763
764
765=head2 Relative backreferences
766
767Counting the opening parentheses to get the correct number for a
768backreference is errorprone as soon as there is more than one
769capturing group. A more convenient technique became available
770with Perl 5.10: relative backreferences. To refer to the immediately
771preceding capture group one now may write C<\g{-1}>, the next but
772last is available via C<\g{-2}>, and so on.
773
774Another good reason in addition to readability and maintainability
775for using relative backreferences is illustrated by the following example,
776where a simple pattern for matching peculiar strings is used:
777
778 $a99a = '([a-z])(\d)\2\1'; # matches a11a, g22g, x33x, etc.
779
780Now that we have this pattern stored as a handy string, we might feel
781tempted to use it as a part of some other pattern:
782
783 $line = "code=e99e";
784 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
785 print "$1 is valid\n";
786 } else {
787 print "bad line: '$line'\n";
788 }
789
790But this doesn't match -- at least not the way one might expect. Only
791after inserting the interpolated C<$a99a> and looking at the resulting
792full text of the regexp is it obvious that the backreferences have
793backfired -- the subexpression C<(\w+)> has snatched number 1 and
794demoted the groups in C<$a99a> by one rank. This can be avoided by
795using relative backreferences:
796
797 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
798
799
800=head2 Named backreferences
801
802Perl 5.10 also introduced named capture buffers and named backreferences.
803To attach a name to a capturing group, you write either
804C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may
805then be written as C<\g{name}>. It is permissible to attach the
806same name to more than one group, but then only the leftmost one of the
807eponymous set can be referenced. Outside of the pattern a named
808capture buffer is accessible through the C<%+> hash.
809
810Assuming that we have to match calendar dates which may be given in one
811of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
812three suitable patterns where we use 'd', 'm' and 'y' respectively as the
813names of the buffers capturing the pertaining components of a date. The
814matching operation combines the three patterns as alternatives:
815
816 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
817 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
818 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
819 for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
820 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
821 print "day=$+{d} month=$+{m} year=$+{y}\n";
822 }
823 }
824
825If any of the alternatives matches, the hash C<%+> is bound to contain the
826three key-value pairs.
827
828
829=head2 Alternative capture group numbering
830
831Yet another capturing group numbering technique (also as from Perl 5.10)
832deals with the problem of referring to groups within a set of alternatives.
833Consider a pattern for matching a time of the day, civil or military style:
47f9c88b 834
7638d2dc
WL
835 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
836 # process hour and minute
837 }
838
839Processing the results requires an additional if statement to determine
840whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would
841be easier if we could use buffer numbers 1 and 2 in second alternative as
842well, and this is exactly what the parenthesized construct C<(?|...)>,
843set around an alternative achieves. Here is an extended version of the
844previous pattern:
845
846 if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
847 print "hour=$1 minute=$2 zone=$3\n";
848 }
849
850Within the alternative numbering group, buffer numbers start at the same
851position for each alternative. After the group, numbering continues
852with one higher than the maximum reached across all the alteratives.
853
854
855=head2 Position information
856
857In addition to what was matched, Perl (since 5.6.0) also provides the
858positions of what was matched as contents of the C<@-> and C<@+>
47f9c88b
GS
859arrays. C<$-[0]> is the position of the start of the entire match and
860C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
861position of the start of the C<$n> match and C<$+[n]> is the position
862of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
863this code
864
865 $x = "Mmm...donut, thought Homer";
866 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
867 foreach $expr (1..$#-) {
868 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
869 }
870
871prints
872
873 Match 1: 'Mmm' at position (0,3)
874 Match 2: 'donut' at position (6,11)
875
876Even if there are no groupings in a regexp, it is still possible to
7638d2dc 877find out what exactly matched in a string. If you use them, Perl
47f9c88b
GS
878will set C<$`> to the part of the string before the match, will set C<$&>
879to the part of the string that matched, and will set C<$'> to the part
880of the string after the match. An example:
881
882 $x = "the cat caught the mouse";
883 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
884 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
885
7638d2dc
WL
886In the second match, C<$`> equals C<''> because the regexp matched at the
887first character position in the string and stopped; it never saw the
47f9c88b 888second 'the'. It is important to note that using C<$`> and C<$'>
7638d2dc 889slows down regexp matching quite a bit, while C<$&> slows it down to a
47f9c88b 890lesser extent, because if they are used in one regexp in a program,
7638d2dc 891they are generated for I<all> regexps in the program. So if raw
47f9c88b 892performance is a goal of your application, they should be avoided.
7638d2dc
WL
893If you need to extract the corresponding substrings, use C<@-> and
894C<@+> instead:
47f9c88b
GS
895
896 $` is the same as substr( $x, 0, $-[0] )
897 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
898 $' is the same as substr( $x, $+[0] )
899
7638d2dc
WL
900
901=head2 Non-capturing groupings
902
903A group that is required to bundle a set of alternatives may or may not be
904useful as a capturing group. If it isn't, it just creates a superfluous
905addition to the set of available capture buffer values, inside as well as
906outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>,
907still allow the regexp to be treated as a single unit, but don't establish
908a capturing buffer at the same time. Both capturing and non-capturing
909groupings are allowed to co-exist in the same regexp. Because there is
910no extraction, non-capturing groupings are faster than capturing
911groupings. Non-capturing groupings are also handy for choosing exactly
912which parts of a regexp are to be extracted to matching variables:
913
914 # match a number, $1-$4 are set, but we only want $1
915 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
916
917 # match a number faster , only $1 is set
918 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
919
920 # match a number, get $1 = whole number, $2 = exponent
921 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
922
923Non-capturing groupings are also useful for removing nuisance
924elements gathered from a split operation where parentheses are
925required for some reason:
926
927 $x = '12aba34ba5';
928 @num = split /(a|b)+/, $x; # @num = ('12','a','34','b','5')
929 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
930
931
47f9c88b
GS
932=head2 Matching repetitions
933
934The examples in the previous section display an annoying weakness. We
7638d2dc
WL
935were only matching 3-letter words, or chunks of words of 4 letters or
936less. We'd like to be able to match words or, more generally, strings
937of any length, without writing out tedious alternatives like
47f9c88b
GS
938C<\w\w\w\w|\w\w\w|\w\w|\w>.
939
7638d2dc
WL
940This is exactly the problem the I<quantifier> metacharacters C<?>,
941C<*>, C<+>, and C<{}> were created for. They allow us to delimit the
942number of repeats for a portion of a regexp we consider to be a
47f9c88b
GS
943match. Quantifiers are put immediately after the character, character
944class, or grouping that we want to specify. They have the following
945meanings:
946
947=over 4
948
551e1d92 949=item *
47f9c88b 950
7638d2dc 951C<a?> means: match 'a' 1 or 0 times
47f9c88b 952
551e1d92
RB
953=item *
954
7638d2dc 955C<a*> means: match 'a' 0 or more times, i.e., any number of times
551e1d92
RB
956
957=item *
47f9c88b 958
7638d2dc 959C<a+> means: match 'a' 1 or more times, i.e., at least once
551e1d92
RB
960
961=item *
962
7638d2dc 963C<a{n,m}> means: match at least C<n> times, but not more than C<m>
47f9c88b
GS
964times.
965
551e1d92
RB
966=item *
967
7638d2dc 968C<a{n,}> means: match at least C<n> or more times
551e1d92
RB
969
970=item *
47f9c88b 971
7638d2dc 972C<a{n}> means: match exactly C<n> times
47f9c88b
GS
973
974=back
975
976Here are some examples:
977
7638d2dc 978 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
47f9c88b
GS
979 # any number of digits
980 /(\w+)\s+\1/; # match doubled words of arbitrary length
981 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
982 $year =~ /\d{2,4}/; # make sure year is at least 2 but not more
983 # than 4 digits
984 $year =~ /\d{4}|\d{2}/; # better match; throw out 3 digit dates
985 $year =~ /\d{2}(\d{2})?/; # same thing written differently. However,
986 # this produces $1 and the other does not.
987
988 % simple_grep '^(\w+)\1$' /usr/dict/words # isn't this easier?
989 beriberi
990 booboo
991 coco
992 mama
993 murmur
994 papa
995
7638d2dc 996For all of these quantifiers, Perl will try to match as much of the
47f9c88b 997string as possible, while still allowing the regexp to succeed. Thus
7638d2dc
WL
998with C</a?.../>, Perl will first try to match the regexp with the C<a>
999present; if that fails, Perl will try to match the regexp without the
47f9c88b
GS
1000C<a> present. For the quantifier C<*>, we get the following:
1001
1002 $x = "the cat in the hat";
1003 $x =~ /^(.*)(cat)(.*)$/; # matches,
1004 # $1 = 'the '
1005 # $2 = 'cat'
1006 # $3 = ' in the hat'
1007
1008Which is what we might expect, the match finds the only C<cat> in the
1009string and locks onto it. Consider, however, this regexp:
1010
1011 $x =~ /^(.*)(at)(.*)$/; # matches,
1012 # $1 = 'the cat in the h'
1013 # $2 = 'at'
7638d2dc 1014 # $3 = '' (0 characters match)
47f9c88b 1015
7638d2dc 1016One might initially guess that Perl would find the C<at> in C<cat> and
47f9c88b
GS
1017stop there, but that wouldn't give the longest possible string to the
1018first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
1019much of the string as possible while still having the regexp match. In
a6b2f353 1020this example, that means having the C<at> sequence with the final C<at>
47f9c88b
GS
1021in the string. The other important principle illustrated here is that
1022when there are two or more elements in a regexp, the I<leftmost>
1023quantifier, if there is one, gets to grab as much the string as
1024possible, leaving the rest of the regexp to fight over scraps. Thus in
1025our example, the first quantifier C<.*> grabs most of the string, while
1026the second quantifier C<.*> gets the empty string. Quantifiers that
7638d2dc
WL
1027grab as much of the string as possible are called I<maximal match> or
1028I<greedy> quantifiers.
47f9c88b
GS
1029
1030When a regexp can match a string in several different ways, we can use
1031the principles above to predict which way the regexp will match:
1032
1033=over 4
1034
1035=item *
551e1d92 1036
47f9c88b
GS
1037Principle 0: Taken as a whole, any regexp will be matched at the
1038earliest possible position in the string.
1039
1040=item *
551e1d92 1041
47f9c88b
GS
1042Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
1043that allows a match for the whole regexp will be the one used.
1044
1045=item *
551e1d92 1046
47f9c88b
GS
1047Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
1048C<{n,m}> will in general match as much of the string as possible while
1049still allowing the whole regexp to match.
1050
1051=item *
551e1d92 1052
47f9c88b
GS
1053Principle 3: If there are two or more elements in a regexp, the
1054leftmost greedy quantifier, if any, will match as much of the string
1055as possible while still allowing the whole regexp to match. The next
1056leftmost greedy quantifier, if any, will try to match as much of the
1057string remaining available to it as possible, while still allowing the
1058whole regexp to match. And so on, until all the regexp elements are
1059satisfied.
1060
1061=back
1062
7638d2dc 1063As we have seen above, Principle 0 overrides the others -- the regexp
47f9c88b
GS
1064will be matched as early as possible, with the other principles
1065determining how the regexp matches at that earliest character
1066position.
1067
1068Here is an example of these principles in action:
1069
1070 $x = "The programming republic of Perl";
1071 $x =~ /^(.+)(e|r)(.*)$/; # matches,
1072 # $1 = 'The programming republic of Pe'
1073 # $2 = 'r'
1074 # $3 = 'l'
1075
1076This regexp matches at the earliest string position, C<'T'>. One
1077might think that C<e>, being leftmost in the alternation, would be
1078matched, but C<r> produces the longest string in the first quantifier.
1079
1080 $x =~ /(m{1,2})(.*)$/; # matches,
1081 # $1 = 'mm'
1082 # $2 = 'ing republic of Perl'
1083
1084Here, The earliest possible match is at the first C<'m'> in
1085C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
1086a maximal C<mm>.
1087
1088 $x =~ /.*(m{1,2})(.*)$/; # matches,
1089 # $1 = 'm'
1090 # $2 = 'ing republic of Perl'
1091
1092Here, the regexp matches at the start of the string. The first
1093quantifier C<.*> grabs as much as possible, leaving just a single
1094C<'m'> for the second quantifier C<m{1,2}>.
1095
1096 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
1097 # $1 = 'a'
1098 # $2 = 'mm'
1099 # $3 = 'ing republic of Perl'
1100
1101Here, C<.?> eats its maximal one character at the earliest possible
1102position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
1103the opportunity to match both C<m>'s. Finally,
1104
1105 "aXXXb" =~ /(X*)/; # matches with $1 = ''
1106
1107because it can match zero copies of C<'X'> at the beginning of the
1108string. If you definitely want to match at least one C<'X'>, use
1109C<X+>, not C<X*>.
1110
1111Sometimes greed is not good. At times, we would like quantifiers to
1112match a I<minimal> piece of string, rather than a maximal piece. For
7638d2dc
WL
1113this purpose, Larry Wall created the I<minimal match> or
1114I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are
47f9c88b
GS
1115the usual quantifiers with a C<?> appended to them. They have the
1116following meanings:
1117
1118=over 4
1119
551e1d92
RB
1120=item *
1121
7638d2dc 1122C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1.
47f9c88b 1123
551e1d92
RB
1124=item *
1125
7638d2dc 1126C<a*?> means: match 'a' 0 or more times, i.e., any number of times,
47f9c88b
GS
1127but as few times as possible
1128
551e1d92
RB
1129=item *
1130
7638d2dc 1131C<a+?> means: match 'a' 1 or more times, i.e., at least once, but
47f9c88b
GS
1132as few times as possible
1133
551e1d92
RB
1134=item *
1135
7638d2dc 1136C<a{n,m}?> means: match at least C<n> times, not more than C<m>
47f9c88b
GS
1137times, as few times as possible
1138
551e1d92
RB
1139=item *
1140
7638d2dc 1141C<a{n,}?> means: match at least C<n> times, but as few times as
47f9c88b
GS
1142possible
1143
551e1d92
RB
1144=item *
1145
7638d2dc 1146C<a{n}?> means: match exactly C<n> times. Because we match exactly
47f9c88b
GS
1147C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1148notational consistency.
1149
1150=back
1151
1152Let's look at the example above, but with minimal quantifiers:
1153
1154 $x = "The programming republic of Perl";
1155 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1156 # $1 = 'Th'
1157 # $2 = 'e'
1158 # $3 = ' programming republic of Perl'
1159
1160The minimal string that will allow both the start of the string C<^>
1161and the alternation to match is C<Th>, with the alternation C<e|r>
1162matching C<e>. The second quantifier C<.*> is free to gobble up the
1163rest of the string.
1164
1165 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1166 # $1 = 'm'
1167 # $2 = 'ming republic of Perl'
1168
1169The first string position that this regexp can match is at the first
1170C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1171matches just one C<'m'>. Although the second quantifier C<.*?> would
1172prefer to match no characters, it is constrained by the end-of-string
1173anchor C<$> to match the rest of the string.
1174
1175 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1176 # $1 = 'The progra'
1177 # $2 = 'm'
1178 # $3 = 'ming republic of Perl'
1179
1180In this regexp, you might expect the first minimal quantifier C<.*?>
1181to match the empty string, because it is not constrained by a C<^>
1182anchor to match the beginning of the word. Principle 0 applies here,
1183however. Because it is possible for the whole regexp to match at the
1184start of the string, it I<will> match at the start of the string. Thus
1185the first quantifier has to match everything up to the first C<m>. The
1186second minimal quantifier matches just one C<m> and the third
1187quantifier matches the rest of the string.
1188
1189 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1190 # $1 = 'a'
1191 # $2 = 'mm'
1192 # $3 = 'ing republic of Perl'
1193
1194Just as in the previous regexp, the first quantifier C<.??> can match
1195earliest at position C<'a'>, so it does. The second quantifier is
1196greedy, so it matches C<mm>, and the third matches the rest of the
1197string.
1198
1199We can modify principle 3 above to take into account non-greedy
1200quantifiers:
1201
1202=over 4
1203
1204=item *
551e1d92 1205
47f9c88b
GS
1206Principle 3: If there are two or more elements in a regexp, the
1207leftmost greedy (non-greedy) quantifier, if any, will match as much
1208(little) of the string as possible while still allowing the whole
1209regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1210any, will try to match as much (little) of the string remaining
1211available to it as possible, while still allowing the whole regexp to
1212match. And so on, until all the regexp elements are satisfied.
1213
1214=back
1215
1216Just like alternation, quantifiers are also susceptible to
1217backtracking. Here is a step-by-step analysis of the example
1218
1219 $x = "the cat in the hat";
1220 $x =~ /^(.*)(at)(.*)$/; # matches,
1221 # $1 = 'the cat in the h'
1222 # $2 = 'at'
1223 # $3 = '' (0 matches)
1224
1225=over 4
1226
551e1d92
RB
1227=item 0
1228
1229Start with the first letter in the string 't'.
47f9c88b 1230
551e1d92
RB
1231=item 1
1232
1233The first quantifier '.*' starts out by matching the whole
47f9c88b
GS
1234string 'the cat in the hat'.
1235
551e1d92
RB
1236=item 2
1237
1238'a' in the regexp element 'at' doesn't match the end of the
47f9c88b
GS
1239string. Backtrack one character.
1240
551e1d92
RB
1241=item 3
1242
1243'a' in the regexp element 'at' still doesn't match the last
47f9c88b
GS
1244letter of the string 't', so backtrack one more character.
1245
551e1d92
RB
1246=item 4
1247
1248Now we can match the 'a' and the 't'.
47f9c88b 1249
551e1d92
RB
1250=item 5
1251
1252Move on to the third element '.*'. Since we are at the end of
47f9c88b
GS
1253the string and '.*' can match 0 times, assign it the empty string.
1254
551e1d92
RB
1255=item 6
1256
1257We are done!
47f9c88b
GS
1258
1259=back
1260
1261Most of the time, all this moving forward and backtracking happens
7638d2dc 1262quickly and searching is fast. There are some pathological regexps,
47f9c88b
GS
1263however, whose execution time exponentially grows with the size of the
1264string. A typical structure that blows up in your face is of the form
1265
1266 /(a|b+)*/;
1267
1268The problem is the nested indeterminate quantifiers. There are many
1269different ways of partitioning a string of length n between the C<+>
1270and C<*>: one repetition with C<b+> of length n, two repetitions with
1271the first C<b+> length k and the second with length n-k, m repetitions
1272whose bits add up to length n, etc. In fact there are an exponential
7638d2dc 1273number of ways to partition a string as a function of its length. A
47f9c88b 1274regexp may get lucky and match early in the process, but if there is
7638d2dc 1275no match, Perl will try I<every> possibility before giving up. So be
47f9c88b 1276careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
7638d2dc 1277I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful
47f9c88b
GS
1278discussion of this and other efficiency issues.
1279
7638d2dc
WL
1280
1281=head2 Possessive quantifiers
1282
1283Backtracking during the relentless search for a match may be a waste
1284of time, particularly when the match is bound to fail. Consider
1285the simple pattern
1286
1287 /^\w+\s+\w+$/; # a word, spaces, a word
1288
1289Whenever this is applied to a string which doesn't quite meet the
1290pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>,
1291the regex engine will backtrack, approximately once for each character
1292in the string. But we know that there is no way around taking I<all>
1293of the inital word characters to match the first repetition, that I<all>
1294spaces must be eaten by the middle part, and the same goes for the second
1295word. With the introduction of the I<possessive quantifiers> in
1296Perl 5.10 we have a way of instructing the regexp engine not to backtrack,
1297with the usual quantifiers with a C<+> appended to them. This makes them
1298greedy as well as stingy; once they succeed they won't give anything back
1299to permit another solution. They have the following meanings:
1300
1301=over 4
1302
1303=item *
1304
1305C<a{n,m}+> means: match at least C<n> times, not more than C<m> times,
1306as many times as possible, and don't give anything up. C<a?+> is short
1307for C<a{0,1}+>
1308
1309=item *
1310
1311C<a{n,}+> means: match at least C<n> times, but as many times as possible,
1312and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is
1313short for C<a{1,}+>.
1314
1315=item *
1316
1317C<a{n}+> means: match exactly C<n> times. It is just there for
1318notational consistency.
1319
1320=back
1321
1322These possessive quantifiers represent a special case of a more general
1323concept, the I<independent subexpression>, see below.
1324
1325As an example where a possessive quantifier is suitable we consider
1326matching a quoted string, as it appears in several programming languages.
1327The backslash is used as an escape character that indicates that the
1328next character is to be taken literally, as another character for the
1329string. Therefore, after the opening quote, we expect a (possibly
1330empty) sequence of alternatives: either some character except an
1331unescaped quote or backslash or an escaped character.
1332
1333 /"(?:[^"\\]++|\\.)*+"/;
1334
1335
47f9c88b
GS
1336=head2 Building a regexp
1337
1338At this point, we have all the basic regexp concepts covered, so let's
1339give a more involved example of a regular expression. We will build a
1340regexp that matches numbers.
1341
1342The first task in building a regexp is to decide what we want to match
1343and what we want to exclude. In our case, we want to match both
1344integers and floating point numbers and we want to reject any string
1345that isn't a number.
1346
1347The next task is to break the problem down into smaller problems that
1348are easily converted into a regexp.
1349
1350The simplest case is integers. These consist of a sequence of digits,
1351with an optional sign in front. The digits we can represent with
1352C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1353regexp is
1354
1355 /[+-]?\d+/; # matches integers
1356
1357A floating point number potentially has a sign, an integral part, a
1358decimal point, a fractional part, and an exponent. One or more of these
1359parts is optional, so we need to check out the different
1360possibilities. Floating point numbers which are in proper form include
1361123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1362front is completely optional and can be matched by C<[+-]?>. We can
1363see that if there is no exponent, floating point numbers must have a
1364decimal point, otherwise they are integers. We might be tempted to
1365model these with C<\d*\.\d*>, but this would also match just a single
1366decimal point, which is not a number. So the three cases of floating
7638d2dc 1367point number without exponent are
47f9c88b
GS
1368
1369 /[+-]?\d+\./; # 1., 321., etc.
1370 /[+-]?\.\d+/; # .1, .234, etc.
1371 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1372
1373These can be combined into a single regexp with a three-way alternation:
1374
1375 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1376
1377In this alternation, it is important to put C<'\d+\.\d+'> before
1378C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1379and ignore the fractional part of the number.
1380
1381Now consider floating point numbers with exponents. The key
1382observation here is that I<both> integers and numbers with decimal
1383points are allowed in front of an exponent. Then exponents, like the
1384overall sign, are independent of whether we are matching numbers with
1385or without decimal points, and can be 'decoupled' from the
1386mantissa. The overall form of the regexp now becomes clear:
1387
1388 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1389
1390The exponent is an C<e> or C<E>, followed by an integer. So the
1391exponent regexp is
1392
1393 /[eE][+-]?\d+/; # exponent
1394
1395Putting all the parts together, we get a regexp that matches numbers:
1396
1397 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1398
1399Long regexps like this may impress your friends, but can be hard to
1400decipher. In complex situations like this, the C<//x> modifier for a
1401match is invaluable. It allows one to put nearly arbitrary whitespace
1402and comments into a regexp without affecting their meaning. Using it,
1403we can rewrite our 'extended' regexp in the more pleasing form
1404
1405 /^
1406 [+-]? # first, match an optional sign
1407 ( # then match integers or f.p. mantissas:
1408 \d+\.\d+ # mantissa of the form a.b
1409 |\d+\. # mantissa of the form a.
1410 |\.\d+ # mantissa of the form .b
1411 |\d+ # integer of the form a
1412 )
1413 ([eE][+-]?\d+)? # finally, optionally match an exponent
1414 $/x;
1415
1416If whitespace is mostly irrelevant, how does one include space
1417characters in an extended regexp? The answer is to backslash it
7638d2dc 1418S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing
47f9c88b 1419goes for pound signs, use C<\#> or C<[#]>. For instance, Perl allows
7638d2dc 1420a space between the sign and the mantissa or integer, and we could add
47f9c88b
GS
1421this to our regexp as follows:
1422
1423 /^
1424 [+-]?\ * # first, match an optional sign *and space*
1425 ( # then match integers or f.p. mantissas:
1426 \d+\.\d+ # mantissa of the form a.b
1427 |\d+\. # mantissa of the form a.
1428 |\.\d+ # mantissa of the form .b
1429 |\d+ # integer of the form a
1430 )
1431 ([eE][+-]?\d+)? # finally, optionally match an exponent
1432 $/x;
1433
1434In this form, it is easier to see a way to simplify the
1435alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1436could be factored out:
1437
1438 /^
1439 [+-]?\ * # first, match an optional sign
1440 ( # then match integers or f.p. mantissas:
1441 \d+ # start out with a ...
1442 (
1443 \.\d* # mantissa of the form a.b or a.
1444 )? # ? takes care of integers of the form a
1445 |\.\d+ # mantissa of the form .b
1446 )
1447 ([eE][+-]?\d+)? # finally, optionally match an exponent
1448 $/x;
1449
1450or written in the compact form,
1451
1452 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1453
1454This is our final regexp. To recap, we built a regexp by
1455
1456=over 4
1457
551e1d92
RB
1458=item *
1459
1460specifying the task in detail,
47f9c88b 1461
551e1d92
RB
1462=item *
1463
1464breaking down the problem into smaller parts,
1465
1466=item *
47f9c88b 1467
551e1d92 1468translating the small parts into regexps,
47f9c88b 1469
551e1d92
RB
1470=item *
1471
1472combining the regexps,
1473
1474=item *
47f9c88b 1475
551e1d92 1476and optimizing the final combined regexp.
47f9c88b
GS
1477
1478=back
1479
1480These are also the typical steps involved in writing a computer
1481program. This makes perfect sense, because regular expressions are
7638d2dc 1482essentially programs written in a little computer language that specifies
47f9c88b
GS
1483patterns.
1484
1485=head2 Using regular expressions in Perl
1486
1487The last topic of Part 1 briefly covers how regexps are used in Perl
1488programs. Where do they fit into Perl syntax?
1489
1490We have already introduced the matching operator in its default
1491C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1492the binding operator C<=~> and its negation C<!~> to test for string
1493matches. Associated with the matching operator, we have discussed the
1494single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
7638d2dc
WL
1495extended C<//x> modifiers. There are a few more things you might
1496want to know about matching operators.
47f9c88b 1497
7638d2dc
WL
1498=head3 Optimizing pattern evaluation
1499
1500We pointed out earlier that variables in regexps are substituted
1501before the regexp is evaluated:
47f9c88b
GS
1502
1503 $pattern = 'Seuss';
1504 while (<>) {
1505 print if /$pattern/;
1506 }
1507
1508This will print any lines containing the word C<Seuss>. It is not as
7638d2dc
WL
1509efficient as it could be, however, because Perl has to re-evaluate
1510(or compile) C<$pattern> each time through the loop. If C<$pattern> won't be
47f9c88b 1511changing over the lifetime of the script, we can add the C<//o>
7638d2dc 1512modifier, which directs Perl to only perform variable substitutions
47f9c88b
GS
1513once:
1514
1515 #!/usr/bin/perl
1516 # Improved simple_grep
1517 $regexp = shift;
1518 while (<>) {
1519 print if /$regexp/o; # a good deal faster
1520 }
1521
7638d2dc
WL
1522
1523=head3 Prohibiting substitution
1524
1525If you change C<$pattern> after the first substitution happens, Perl
47f9c88b
GS
1526will ignore it. If you don't want any substitutions at all, use the
1527special delimiter C<m''>:
1528
16e8b840 1529 @pattern = ('Seuss');
47f9c88b 1530 while (<>) {
16e8b840 1531 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
47f9c88b
GS
1532 }
1533
7638d2dc
WL
1534Similar to strings, C<m''> acts like apostrophes on a regexp; all other
1535C<m> delimiters act like quotes. If the regexp evaluates to the empty string,
47f9c88b
GS
1536the regexp in the I<last successful match> is used instead. So we have
1537
1538 "dog" =~ /d/; # 'd' matches
1539 "dogbert =~ //; # this matches the 'd' regexp used before
1540
7638d2dc
WL
1541
1542=head3 Global matching
1543
47f9c88b 1544The final two modifiers C<//g> and C<//c> concern multiple matches.
da75cd15 1545The modifier C<//g> stands for global matching and allows the
47f9c88b
GS
1546matching operator to match within a string as many times as possible.
1547In scalar context, successive invocations against a string will have
1548`C<//g> jump from match to match, keeping track of position in the
1549string as it goes along. You can get or set the position with the
1550C<pos()> function.
1551
1552The use of C<//g> is shown in the following example. Suppose we have
1553a string that consists of words separated by spaces. If we know how
1554many words there are in advance, we could extract the words using
1555groupings:
1556
1557 $x = "cat dog house"; # 3 words
1558 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1559 # $1 = 'cat'
1560 # $2 = 'dog'
1561 # $3 = 'house'
1562
1563But what if we had an indeterminate number of words? This is the sort
1564of task C<//g> was made for. To extract all words, form the simple
1565regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1566
1567 while ($x =~ /(\w+)/g) {
1568 print "Word is $1, ends at position ", pos $x, "\n";
1569 }
1570
1571prints
1572
1573 Word is cat, ends at position 3
1574 Word is dog, ends at position 7
1575 Word is house, ends at position 13
1576
1577A failed match or changing the target string resets the position. If
1578you don't want the position reset after failure to match, add the
1579C<//c>, as in C</regexp/gc>. The current position in the string is
1580associated with the string, not the regexp. This means that different
1581strings have different positions and their respective positions can be
1582set or read independently.
1583
1584In list context, C<//g> returns a list of matched groupings, or if
1585there are no groupings, a list of matches to the whole regexp. So if
1586we wanted just the words, we could use
1587
1588 @words = ($x =~ /(\w+)/g); # matches,
1589 # $word[0] = 'cat'
1590 # $word[1] = 'dog'
1591 # $word[2] = 'house'
1592
1593Closely associated with the C<//g> modifier is the C<\G> anchor. The
1594C<\G> anchor matches at the point where the previous C<//g> match left
1595off. C<\G> allows us to easily do context-sensitive matching:
1596
1597 $metric = 1; # use metric units
1598 ...
1599 $x = <FILE>; # read in measurement
1600 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1601 $weight = $1;
1602 if ($metric) { # error checking
1603 print "Units error!" unless $x =~ /\Gkg\./g;
1604 }
1605 else {
1606 print "Units error!" unless $x =~ /\Glbs\./g;
1607 }
1608 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1609
1610The combination of C<//g> and C<\G> allows us to process the string a
1611bit at a time and use arbitrary Perl logic to decide what to do next.
25cf8c22
HS
1612Currently, the C<\G> anchor is only fully supported when used to anchor
1613to the start of the pattern.
47f9c88b
GS
1614
1615C<\G> is also invaluable in processing fixed length records with
1616regexps. Suppose we have a snippet of coding region DNA, encoded as
1617base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1618codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1619we can think of the DNA snippet as a sequence of 3-letter records. The
1620naive regexp
1621
1622 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1623 $dna = "ATCGTTGAATGCAAATGACATGAC";
1624 $dna =~ /TGA/;
1625
d1be9408 1626doesn't work; it may match a C<TGA>, but there is no guarantee that
47f9c88b 1627the match is aligned with codon boundaries, e.g., the substring
7638d2dc 1628S<C<GTT GAA>> gives a match. A better solution is
47f9c88b
GS
1629
1630 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1631 print "Got a TGA stop codon at position ", pos $dna, "\n";
1632 }
1633
1634which prints
1635
1636 Got a TGA stop codon at position 18
1637 Got a TGA stop codon at position 23
1638
1639Position 18 is good, but position 23 is bogus. What happened?
1640
1641The answer is that our regexp works well until we get past the last
1642real match. Then the regexp will fail to match a synchronized C<TGA>
1643and start stepping ahead one character position at a time, not what we
1644want. The solution is to use C<\G> to anchor the match to the codon
1645alignment:
1646
1647 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1648 print "Got a TGA stop codon at position ", pos $dna, "\n";
1649 }
1650
1651This prints
1652
1653 Got a TGA stop codon at position 18
1654
1655which is the correct answer. This example illustrates that it is
1656important not only to match what is desired, but to reject what is not
1657desired.
1658
7638d2dc 1659=head3 Search and replace
47f9c88b 1660
7638d2dc 1661Regular expressions also play a big role in I<search and replace>
47f9c88b
GS
1662operations in Perl. Search and replace is accomplished with the
1663C<s///> operator. The general form is
1664C<s/regexp/replacement/modifiers>, with everything we know about
1665regexps and modifiers applying in this case as well. The
1666C<replacement> is a Perl double quoted string that replaces in the
1667string whatever is matched with the C<regexp>. The operator C<=~> is
1668also used here to associate a string with C<s///>. If matching
7638d2dc 1669against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match,
47f9c88b
GS
1670C<s///> returns the number of substitutions made, otherwise it returns
1671false. Here are a few examples:
1672
1673 $x = "Time to feed the cat!";
1674 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1675 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1676 $more_insistent = 1;
1677 }
1678 $y = "'quoted words'";
1679 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1680 # $y contains "quoted words"
1681
1682In the last example, the whole string was matched, but only the part
1683inside the single quotes was grouped. With the C<s///> operator, the
1684matched variables C<$1>, C<$2>, etc. are immediately available for use
1685in the replacement expression, so we use C<$1> to replace the quoted
1686string with just what was quoted. With the global modifier, C<s///g>
1687will search and replace all occurrences of the regexp in the string:
1688
1689 $x = "I batted 4 for 4";
1690 $x =~ s/4/four/; # doesn't do it all:
1691 # $x contains "I batted four for 4"
1692 $x = "I batted 4 for 4";
1693 $x =~ s/4/four/g; # does it all:
1694 # $x contains "I batted four for four"
1695
1696If you prefer 'regex' over 'regexp' in this tutorial, you could use
1697the following program to replace it:
1698
1699 % cat > simple_replace
1700 #!/usr/bin/perl
1701 $regexp = shift;
1702 $replacement = shift;
1703 while (<>) {
1704 s/$regexp/$replacement/go;
1705 print;
1706 }
1707 ^D
1708
1709 % simple_replace regexp regex perlretut.pod
1710
1711In C<simple_replace> we used the C<s///g> modifier to replace all
1712occurrences of the regexp on each line and the C<s///o> modifier to
1713compile the regexp only once. As with C<simple_grep>, both the
1714C<print> and the C<s/$regexp/$replacement/go> use C<$_> implicitly.
1715
1716A modifier available specifically to search and replace is the
1717C<s///e> evaluation modifier. C<s///e> wraps an C<eval{...}> around
1718the replacement string and the evaluated result is substituted for the
1719matched substring. C<s///e> is useful if you need to do a bit of
1720computation in the process of replacing text. This example counts
1721character frequencies in a line:
1722
1723 $x = "Bill the cat";
1724 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1725 print "frequency of '$_' is $chars{$_}\n"
1726 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1727
1728This prints
1729
1730 frequency of ' ' is 2
1731 frequency of 't' is 2
1732 frequency of 'l' is 2
1733 frequency of 'B' is 1
1734 frequency of 'c' is 1
1735 frequency of 'e' is 1
1736 frequency of 'h' is 1
1737 frequency of 'i' is 1
1738 frequency of 'a' is 1
1739
1740As with the match C<m//> operator, C<s///> can use other delimiters,
1741such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
1742used C<s'''>, then the regexp and replacement are treated as single
1743quoted strings and there are no substitutions. C<s///> in list context
1744returns the same thing as in scalar context, i.e., the number of
1745matches.
1746
7638d2dc 1747=head3 The split function
47f9c88b 1748
7638d2dc
WL
1749The C<split()> function is another place where a regexp is used.
1750C<split /regexp/, string, limit> separates the C<string> operand into
1751a list of substrings and returns that list. The regexp must be designed
1752to match whatever constitutes the separators for the desired substrings.
1753The C<limit>, if present, constrains splitting into no more than C<limit>
1754number of strings. For example, to split a string into words, use
47f9c88b
GS
1755
1756 $x = "Calvin and Hobbes";
1757 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1758 # $word[1] = 'and'
1759 # $word[2] = 'Hobbes'
1760
1761If the empty regexp C<//> is used, the regexp always matches and
1762the string is split into individual characters. If the regexp has
7638d2dc 1763groupings, then the resulting list contains the matched substrings from the
47f9c88b
GS
1764groupings as well. For instance,
1765
1766 $x = "/usr/bin/perl";
1767 @dirs = split m!/!, $x; # $dirs[0] = ''
1768 # $dirs[1] = 'usr'
1769 # $dirs[2] = 'bin'
1770 # $dirs[3] = 'perl'
1771 @parts = split m!(/)!, $x; # $parts[0] = ''
1772 # $parts[1] = '/'
1773 # $parts[2] = 'usr'
1774 # $parts[3] = '/'
1775 # $parts[4] = 'bin'
1776 # $parts[5] = '/'
1777 # $parts[6] = 'perl'
1778
1779Since the first character of $x matched the regexp, C<split> prepended
1780an empty initial element to the list.
1781
1782If you have read this far, congratulations! You now have all the basic
1783tools needed to use regular expressions to solve a wide range of text
1784processing problems. If this is your first time through the tutorial,
1785why not stop here and play around with regexps a while... S<Part 2>
1786concerns the more esoteric aspects of regular expressions and those
1787concepts certainly aren't needed right at the start.
1788
1789=head1 Part 2: Power tools
1790
1791OK, you know the basics of regexps and you want to know more. If
1792matching regular expressions is analogous to a walk in the woods, then
1793the tools discussed in Part 1 are analogous to topo maps and a
1794compass, basic tools we use all the time. Most of the tools in part 2
da75cd15 1795are analogous to flare guns and satellite phones. They aren't used
47f9c88b
GS
1796too often on a hike, but when we are stuck, they can be invaluable.
1797
1798What follows are the more advanced, less used, or sometimes esoteric
7638d2dc 1799capabilities of Perl regexps. In Part 2, we will assume you are
47f9c88b
GS
1800comfortable with the basics and concentrate on the new features.
1801
1802=head2 More on characters, strings, and character classes
1803
1804There are a number of escape sequences and character classes that we
1805haven't covered yet.
1806
1807There are several escape sequences that convert characters or strings
7638d2dc
WL
1808between upper and lower case, and they are also available within
1809patterns. C<\l> and C<\u> convert the next character to lower or
1810upper case, respectively:
47f9c88b
GS
1811
1812 $x = "perl";
1813 $string =~ /\u$x/; # matches 'Perl' in $string
1814 $x = "M(rs?|s)\\."; # note the double backslash
1815 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1816
7638d2dc
WL
1817A C<\L> or C<\U> indicates a lasting conversion of case, until
1818terminated by C<\E> or thrown over by another C<\U> or C<\L>:
47f9c88b
GS
1819
1820 $x = "This word is in lower case:\L SHOUT\E";
1821 $x =~ /shout/; # matches
1822 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1823 $x =~ /\Ukeypunch/; # matches punch card string
1824
1825If there is no C<\E>, case is converted until the end of the
1826string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1827character of C<$word> to uppercase and the rest of the characters to
1828lowercase.
1829
1830Control characters can be escaped with C<\c>, so that a control-Z
1831character would be matched with C<\cZ>. The escape sequence
1832C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1833instance,
1834
1835 $x = "\QThat !^*&%~& cat!";
1836 $x =~ /\Q!^*&%~&\E/; # check for rough language
1837
1838It does not protect C<$> or C<@>, so that variables can still be
1839substituted.
1840
7638d2dc
WL
1841With the advent of 5.6.0, Perl regexps can handle more than just the
1842standard ASCII character set. Perl now supports I<Unicode>, a standard
1843for representing the alphabets from virtually all of the world's written
38a44b82 1844languages, and a host of symbols. Perl's text strings are Unicode strings, so
2575c402
JW
1845they can contain characters with a value (codepoint or character number) higher
1846than 255
47f9c88b
GS
1847
1848What does this mean for regexps? Well, regexp users don't need to know
7638d2dc 1849much about Perl's internal representation of strings. But they do need
2575c402
JW
1850to know 1) how to represent Unicode characters in a regexp and 2) that
1851a matching operation will treat the string to be searched as a sequence
1852of characters, not bytes. The answer to 1) is that Unicode characters
1853greater than C<chr(255)> are represented using the C<\x{hex}> notation,
1854because the \0 octal and \x hex (without curly braces) don't go further
1855than 255.
47f9c88b 1856
47f9c88b
GS
1857 /\x{263a}/; # match a Unicode smiley face :)
1858
7638d2dc 1859B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use
72ff2908
JH
1860utf8> to use any Unicode features. This is no more the case: for
1861almost all Unicode processing, the explicit C<utf8> pragma is not
1862needed. (The only case where it matters is if your Perl script is in
1863Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
47f9c88b
GS
1864
1865Figuring out the hexadecimal sequence of a Unicode character you want
1866or deciphering someone else's hexadecimal Unicode regexp is about as
1867much fun as programming in machine code. So another way to specify
7638d2dc 1868Unicode characters is to use the I<named character>> escape
47f9c88b 1869sequence C<\N{name}>. C<name> is a name for the Unicode character, as
55eda711
JH
1870specified in the Unicode standard. For instance, if we wanted to
1871represent or match the astrological sign for the planet Mercury, we
1872could use
47f9c88b 1873
47f9c88b
GS
1874 use charnames ":full"; # use named chars with Unicode full names
1875 $x = "abc\N{MERCURY}def";
1876 $x =~ /\N{MERCURY}/; # matches
1877
1878One can also use short names or restrict names to a certain alphabet:
1879
47f9c88b
GS
1880 use charnames ':full';
1881 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
1882
1883 use charnames ":short";
1884 print "\N{greek:Sigma} is an upper-case sigma.\n";
1885
1886 use charnames qw(greek);
1887 print "\N{sigma} is Greek sigma\n";
1888
7638d2dc
WL
1889A list of full names is found in the file NamesList.txt in the
1890lib/perl5/X.X.X/unicore directory (where X.X.X is the perl
1891version number as it is installed on your system).
47f9c88b 1892
38a44b82 1893The answer to requirement 2), as of 5.6.0, is that a regexp uses Unicode
2575c402
JW
1894characters. Internally, this is encoded to bytes using either UTF-8 or a
1895native 8 bit encoding, depending on the history of the string, but
1896conceptually it is a sequence of characters, not bytes. See
1897L<perlunitut> for a tutorial about that.
1898
1899Let us now discuss Unicode character classes. Just as with Unicode
1900characters, there are named Unicode character classes represented by the
1901C<\p{name}> escape sequence. Closely associated is the C<\P{name}>
1902character class, which is the negation of the C<\p{name}> class. For
1903example, to match lower and uppercase characters,
47f9c88b 1904
47f9c88b
GS
1905 use charnames ":full"; # use named chars with Unicode full names
1906 $x = "BOB";
1907 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1908 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1909 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1910 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1911
86929931
JH
1912Here is the association between some Perl named classes and the
1913traditional Unicode classes:
47f9c88b 1914
86929931 1915 Perl class name Unicode class name or regular expression
47f9c88b 1916
f5868911
JH
1917 IsAlpha /^[LM]/
1918 IsAlnum /^[LMN]/
1919 IsASCII $code <= 127
1920 IsCntrl /^C/
1921 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
47f9c88b 1922 IsDigit Nd
f5868911 1923 IsGraph /^([LMNPS]|Co)/
47f9c88b 1924 IsLower Ll
f5868911
JH
1925 IsPrint /^([LMNPS]|Co|Zs)/
1926 IsPunct /^P/
1927 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
08ce8fc6 1928 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
f5868911
JH
1929 IsUpper /^L[ut]/
1930 IsWord /^[LMN]/ || $code eq "005F"
47f9c88b
GS
1931 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1932
86929931
JH
1933You can also use the official Unicode class names with the C<\p> and
1934C<\P>, like C<\p{L}> for Unicode 'letters', or C<\p{Lu}> for uppercase
1935letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1936letter, the braces can be dropped. For instance, C<\pM> is the
98f22ffc 1937character class of Unicode 'marks', for example accent marks.
32293815
JH
1938For the full list see L<perlunicode>.
1939
fa11829f 1940The Unicode has also been separated into various sets of characters
7638d2dc
WL
1941which you can test with C<\p{...}> (in) and C<\P{...}> (not in).
1942To test whether a character is (or is not) an element of a script
1943you would use the script name, for example C<\p{Latin}>, C<\p{Greek}>,
1944or C<\P{Katakana}>. Other sets are the Unicode blocks, the names
1945of which begin with "In". One such block is dedicated to mathematical
1946operators, and its pattern formula is <C\p{InMathematicalOperators>}>.
5e42d7b4 1947For the full list see L<perlunicode>.
47f9c88b 1948
7638d2dc
WL
1949C<\X> is an abbreviation for a character class that comprises
1950the Unicode I<combining character sequences>. A combining character
1951sequence is a base character followed by any number of diacritics, i.e.,
1952signs like accents used to indicate different sounds of a letter. Using
1953the Unicode full names, e.g., S<C<A + COMBINING RING>> is a combining
47f9c88b 1954character sequence with base character C<A> and combining character
7638d2dc 1955S<C<COMBINING RING>>, which translates in Danish to A with the circle
47f9c88b
GS
1956atop it, as in the word Angstrom. C<\X> is equivalent to C<\PM\pM*}>,
1957i.e., a non-mark followed by one or more marks.
1958
da75cd15 1959For the full and latest information about Unicode see the latest
5e42d7b4
JH
1960Unicode standard, or the Unicode Consortium's website http://www.unicode.org/
1961
47f9c88b
GS
1962As if all those classes weren't enough, Perl also defines POSIX style
1963character classes. These have the form C<[:name:]>, with C<name> the
aaa51d5e
JF
1964name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
1965C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
1966C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
1967extension to match C<\w>), and C<blank> (a GNU extension). If C<utf8>
1968is being used, then these classes are defined the same as their
7638d2dc 1969corresponding Perl Unicode classes: C<[:upper:]> is the same as
aaa51d5e
JF
1970C<\p{IsUpper}>, etc. The POSIX character classes, however, don't
1971require using C<utf8>. The C<[:digit:]>, C<[:word:]>, and
47f9c88b 1972C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
aaa51d5e
JF
1973character classes. To negate a POSIX class, put a C<^> in front of
1974the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and under
47f9c88b 1975C<utf8>, C<\P{IsDigit}>. The Unicode and POSIX character classes can
54c18d04
MK
1976be used just like C<\d>, with the exception that POSIX character
1977classes can only be used inside of a character class:
47f9c88b
GS
1978
1979 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
54c18d04 1980 /^=item\s[[:digit:]]/; # match '=item',
47f9c88b 1981 # followed by a space and a digit
47f9c88b
GS
1982 use charnames ":full";
1983 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
1984 /^=item\s\p{IsDigit}/; # match '=item',
1985 # followed by a space and a digit
1986
1987Whew! That is all the rest of the characters and character classes.
1988
1989=head2 Compiling and saving regular expressions
1990
1991In Part 1 we discussed the C<//o> modifier, which compiles a regexp
1992just once. This suggests that a compiled regexp is some data structure
1993that can be stored once and used again and again. The regexp quote
1994C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
1995regexp and transforms the result into a form that can be assigned to a
1996variable:
1997
1998 $reg = qr/foo+bar?/; # reg contains a compiled regexp
1999
2000Then C<$reg> can be used as a regexp:
2001
2002 $x = "fooooba";
2003 $x =~ $reg; # matches, just like /foo+bar?/
2004 $x =~ /$reg/; # same thing, alternate form
2005
2006C<$reg> can also be interpolated into a larger regexp:
2007
2008 $x =~ /(abc)?$reg/; # still matches
2009
2010As with the matching operator, the regexp quote can use different
7638d2dc
WL
2011delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes
2012as delimiters (C<qr''>) inhibit any interpolation.
47f9c88b
GS
2013
2014Pre-compiled regexps are useful for creating dynamic matches that
2015don't need to be recompiled each time they are encountered. Using
7638d2dc
WL
2016pre-compiled regexps, we write a C<grep_step> program which greps
2017for a sequence of patterns, advancing to the next pattern as soon
2018as one has been satisfied.
47f9c88b 2019
7638d2dc 2020 % cat > grep_step
47f9c88b 2021 #!/usr/bin/perl
7638d2dc 2022 # grep_step - match <number> regexps, one after the other
47f9c88b
GS
2023 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2024
2025 $number = shift;
2026 $regexp[$_] = shift foreach (0..$number-1);
2027 @compiled = map qr/$_/, @regexp;
2028 while ($line = <>) {
7638d2dc
WL
2029 if ($line =~ /$compiled[0]/) {
2030 print $line;
2031 shift @compiled;
2032 last unless @compiled;
47f9c88b
GS
2033 }
2034 }
2035 ^D
2036
7638d2dc
WL
2037 % grep_step 3 shift print last grep_step
2038 $number = shift;
2039 print $line;
2040 last unless @compiled;
47f9c88b
GS
2041
2042Storing pre-compiled regexps in an array C<@compiled> allows us to
2043simply loop through the regexps without any recompilation, thus gaining
2044flexibility without sacrificing speed.
2045
7638d2dc
WL
2046
2047=head2 Composing regular expressions at runtime
2048
2049Backtracking is more efficient than repeated tries with different regular
2050expressions. If there are several regular expressions and a match with
2051any of them is acceptable, then it is possible to combine them into a set
2052of alternatives. If the individual expressions are input data, this
2053can be done by programming a join operation. We'll exploit this idea in
2054an improved version of the C<simple_grep> program: a program that matches
2055multiple patterns:
2056
2057 % cat > multi_grep
2058 #!/usr/bin/perl
2059 # multi_grep - match any of <number> regexps
2060 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2061
2062 $number = shift;
2063 $regexp[$_] = shift foreach (0..$number-1);
2064 $pattern = join '|', @regexp;
2065
2066 while ($line = <>) {
2067 print $line if $line =~ /$pattern/o;
2068 }
2069 ^D
2070
2071 % multi_grep 2 shift for multi_grep
2072 $number = shift;
2073 $regexp[$_] = shift foreach (0..$number-1);
2074
2075Sometimes it is advantageous to construct a pattern from the I<input>
2076that is to be analyzed and use the permissible values on the left
2077hand side of the matching operations. As an example for this somewhat
2078paradoxical situation, let's assume that our input contains a command
2079verb which should match one out of a set of available command verbs,
2080with the additional twist that commands may be abbreviated as long as
2081the given string is unique. The program below demonstrates the basic
2082algorithm.
2083
2084 % cat > keymatch
2085 #!/usr/bin/perl
2086 $kwds = 'copy compare list print';
2087 while( $command = <> ){
2088 $command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
2089 if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
2090 print "command: '$matches'\n";
2091 } elsif( @matches == 0 ){
2092 print "no such command: '$command'\n";
2093 } else {
2094 print "not unique: '$command' (could be one of: @matches)\n";
2095 }
2096 }
2097 ^D
2098
2099 % keymatch
2100 li
2101 command: 'list'
2102 co
2103 not unique: 'co' (could be one of: copy compare)
2104 printer
2105 no such command: 'printer'
2106
2107Rather than trying to match the input against the keywords, we match the
2108combined set of keywords against the input. The pattern matching
2109operation S<C<$kwds =~ /\b($command\w*)/g>> does several things at the
2110same time. It makes sure that the given command begins where a keyword
2111begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It
2112tells us the number of matches (C<scalar @matches>) and all the keywords
2113that were actually matched. You could hardly ask for more.
2114
2115
47f9c88b
GS
2116=head2 Embedding comments and modifiers in a regular expression
2117
2118Starting with this section, we will be discussing Perl's set of
7638d2dc 2119I<extended patterns>. These are extensions to the traditional regular
47f9c88b
GS
2120expression syntax that provide powerful new tools for pattern
2121matching. We have already seen extensions in the form of the minimal
2122matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. The
2123rest of the extensions below have the form C<(?char...)>, where the
2124C<char> is a character that determines the type of extension.
2125
2126The first extension is an embedded comment C<(?#text)>. This embeds a
2127comment into the regular expression without affecting its meaning. The
2128comment should not have any closing parentheses in the text. An
2129example is
2130
2131 /(?# Match an integer:)[+-]?\d+/;
2132
2133This style of commenting has been largely superseded by the raw,
2134freeform commenting that is allowed with the C<//x> modifier.
2135
7638d2dc
WL
2136The modifiers C<//i>, C<//m>, C<//s>, C<//x> and C<//k> (or any
2137combination thereof) can also embedded in
47f9c88b
GS
2138a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
2139
2140 /(?i)yes/; # match 'yes' case insensitively
2141 /yes/i; # same thing
2142 /(?x)( # freeform version of an integer regexp
2143 [+-]? # match an optional sign
2144 \d+ # match a sequence of digits
2145 )
2146 /x;
2147
2148Embedded modifiers can have two important advantages over the usual
2149modifiers. Embedded modifiers allow a custom set of modifiers to
2150I<each> regexp pattern. This is great for matching an array of regexps
2151that must have different modifiers:
2152
2153 $pattern[0] = '(?i)doctor';
2154 $pattern[1] = 'Johnson';
2155 ...
2156 while (<>) {
2157 foreach $patt (@pattern) {
2158 print if /$patt/;
2159 }
2160 }
2161
7638d2dc
WL
2162The second advantage is that embedded modifiers (except C<//k>, which
2163modifies the entire regexp) only affect the regexp
47f9c88b
GS
2164inside the group the embedded modifier is contained in. So grouping
2165can be used to localize the modifier's effects:
2166
2167 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
2168
2169Embedded modifiers can also turn off any modifiers already present
2170by using, e.g., C<(?-i)>. Modifiers can also be combined into
2171a single expression, e.g., C<(?s-i)> turns on single line mode and
2172turns off case insensitivity.
2173
7638d2dc 2174Embedded modifiers may also be added to a non-capturing grouping.
47f9c88b
GS
2175C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
2176case insensitively and turns off multi-line mode.
2177
7638d2dc 2178
47f9c88b
GS
2179=head2 Looking ahead and looking behind
2180
2181This section concerns the lookahead and lookbehind assertions. First,
2182a little background.
2183
2184In Perl regular expressions, most regexp elements 'eat up' a certain
2185amount of string when they match. For instance, the regexp element
2186C<[abc}]> eats up one character of the string when it matches, in the
7638d2dc 2187sense that Perl moves to the next character position in the string
47f9c88b
GS
2188after the match. There are some elements, however, that don't eat up
2189characters (advance the character position) if they match. The examples
2190we have seen so far are the anchors. The anchor C<^> matches the
2191beginning of the line, but doesn't eat any characters. Similarly, the
7638d2dc
WL
2192word boundary anchor C<\b> matches wherever a character matching C<\w>
2193is next to a character that doesn't, but it doesn't eat up any
2194characters itself. Anchors are examples of I<zero-width assertions>.
2195Zero-width, because they consume
47f9c88b
GS
2196no characters, and assertions, because they test some property of the
2197string. In the context of our walk in the woods analogy to regexp
2198matching, most regexp elements move us along a trail, but anchors have
2199us stop a moment and check our surroundings. If the local environment
2200checks out, we can proceed forward. But if the local environment
2201doesn't satisfy us, we must backtrack.
2202
2203Checking the environment entails either looking ahead on the trail,
2204looking behind, or both. C<^> looks behind, to see that there are no
2205characters before. C<$> looks ahead, to see that there are no
2206characters after. C<\b> looks both ahead and behind, to see if the
7638d2dc 2207characters on either side differ in their "word-ness".
47f9c88b
GS
2208
2209The lookahead and lookbehind assertions are generalizations of the
2210anchor concept. Lookahead and lookbehind are zero-width assertions
2211that let us specify which characters we want to test for. The
2212lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
a6b2f353 2213assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
47f9c88b
GS
2214
2215 $x = "I catch the housecat 'Tom-cat' with catnip";
7638d2dc 2216 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
47f9c88b
GS
2217 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
2218 # $catwords[0] = 'catch'
2219 # $catwords[1] = 'catnip'
2220 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
2221 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
2222 # middle of $x
2223
a6b2f353 2224Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
47f9c88b
GS
2225non-capturing, since these are zero-width assertions. Thus in the
2226second regexp, the substrings captured are those of the whole regexp
a6b2f353
GS
2227itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
2228lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
2229width, i.e., a fixed number of characters long. Thus
2230C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2231negated versions of the lookahead and lookbehind assertions are
2232denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2233They evaluate true if the regexps do I<not> match:
47f9c88b
GS
2234
2235 $x = "foobar";
2236 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2237 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2238 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2239
f14c76ed
RGS
2240The C<\C> is unsupported in lookbehind, because the already
2241treacherous definition of C<\C> would become even more so
2242when going backwards.
2243
7638d2dc
WL
2244Here is an example where a string containing blank-separated words,
2245numbers and single dashes is to be split into its components.
2246Using C</\s+/> alone won't work, because spaces are not required between
2247dashes, or a word or a dash. Additional places for a split are established
2248by looking ahead and behind:
47f9c88b 2249
7638d2dc
WL
2250 $str = "one two - --6-8";
2251 @toks = split / \s+ # a run of spaces
2252 | (?<=\S) (?=-) # any non-space followed by '-'
2253 | (?<=-) (?=\S) # a '-' followed by any non-space
2254 /x, $str; # @toks = qw(one two - - - 6 - 8)
47f9c88b 2255
7638d2dc
WL
2256
2257=head2 Using independent subexpressions to prevent backtracking
2258
2259I<Independent subexpressions> are regular expressions, in the
47f9c88b
GS
2260context of a larger regular expression, that function independently of
2261the larger regular expression. That is, they consume as much or as
2262little of the string as they wish without regard for the ability of
2263the larger regexp to match. Independent subexpressions are represented
2264by C<< (?>regexp) >>. We can illustrate their behavior by first
2265considering an ordinary regexp:
2266
2267 $x = "ab";
2268 $x =~ /a*ab/; # matches
2269
2270This obviously matches, but in the process of matching, the
2271subexpression C<a*> first grabbed the C<a>. Doing so, however,
2272wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2273eventually gave back the C<a> and matched the empty string. Here, what
2274C<a*> matched was I<dependent> on what the rest of the regexp matched.
2275
2276Contrast that with an independent subexpression:
2277
2278 $x =~ /(?>a*)ab/; # doesn't match!
2279
2280The independent subexpression C<< (?>a*) >> doesn't care about the rest
2281of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2282regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
da75cd15 2283is no backtracking and the independent subexpression does not give
47f9c88b
GS
2284up its C<a>. Thus the match of the regexp as a whole fails. A similar
2285behavior occurs with completely independent regexps:
2286
2287 $x = "ab";
2288 $x =~ /a*/g; # matches, eats an 'a'
2289 $x =~ /\Gab/g; # doesn't match, no 'a' available
2290
2291Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2292one regexp to the other. Regexps with an independent subexpression are
2293much like this, with a handoff of the string to the independent
2294subexpression, and a handoff of the string back to the enclosing
2295regexp.
2296
2297The ability of an independent subexpression to prevent backtracking
2298can be quite useful. Suppose we want to match a non-empty string
2299enclosed in parentheses up to two levels deep. Then the following
2300regexp matches:
2301
2302 $x = "abc(de(fg)h"; # unbalanced parentheses
2303 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2304
2305The regexp matches an open parenthesis, one or more copies of an
2306alternation, and a close parenthesis. The alternation is two-way, with
2307the first alternative C<[^()]+> matching a substring with no
2308parentheses and the second alternative C<\([^()]*\)> matching a
2309substring delimited by parentheses. The problem with this regexp is
2310that it is pathological: it has nested indeterminate quantifiers
07698885 2311of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
47f9c88b
GS
2312like this could take an exponentially long time to execute if there
2313was no match possible. To prevent the exponential blowup, we need to
2314prevent useless backtracking at some point. This can be done by
2315enclosing the inner quantifier as an independent subexpression:
2316
2317 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2318
2319Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2320by gobbling up as much of the string as possible and keeping it. Then
2321match failures fail much more quickly.
2322
7638d2dc 2323
47f9c88b
GS
2324=head2 Conditional expressions
2325
7638d2dc 2326A I<conditional expression> is a form of if-then-else statement
47f9c88b
GS
2327that allows one to choose which patterns are to be matched, based on
2328some condition. There are two types of conditional expression:
2329C<(?(condition)yes-regexp)> and
2330C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
7638d2dc 2331like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true,
47f9c88b 2332the C<yes-regexp> will be matched. If the C<condition> is false, the
7638d2dc
WL
2333C<yes-regexp> will be skipped and Perl will move onto the next regexp
2334element. The second form is like an S<C<'if () {} else {}'>> statement
47f9c88b
GS
2335in Perl. If the C<condition> is true, the C<yes-regexp> will be
2336matched, otherwise the C<no-regexp> will be matched.
2337
7638d2dc 2338The C<condition> can have several forms. The first form is simply an
47f9c88b 2339integer in parentheses C<(integer)>. It is true if the corresponding
7638d2dc
WL
2340backreference C<\integer> matched earlier in the regexp. The same
2341thing can be done with a name associated with a capture buffer, written
2342as C<< (<name>) >> or C<< ('name') >>. The second form is a bare
2343zero width assertion C<(?...)>, either a lookahead, a lookbehind, or a
2344code assertion (discussed in the next section). The third set of forms
2345provides tests that return true if the expression is executed within
2346a recursion (C<(R)>) or is being called from some capturing group,
2347referenced either by number (C<(R1)>, C<(R2)>,...) or by name
2348(C<(R&name)>).
2349
2350The integer or name form of the C<condition> allows us to choose,
2351with more flexibility, what to match based on what matched earlier in the
2352regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">:
47f9c88b
GS
2353
2354 % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
2355 beriberi
2356 coco
2357 couscous
2358 deed
2359 ...
2360 toot
2361 toto
2362 tutu
2363
2364The lookbehind C<condition> allows, along with backreferences,
2365an earlier part of the match to influence a later part of the
2366match. For instance,
2367
2368 /[ATGC]+(?(?<=AA)G|C)$/;
2369
2370matches a DNA sequence such that it either ends in C<AAG>, or some
2371other base pair combination and C<C>. Note that the form is
a6b2f353
GS
2372C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2373lookahead, lookbehind or code assertions, the parentheses around the
2374conditional are not needed.
47f9c88b 2375
7638d2dc
WL
2376
2377=head2 Defining named patterns
2378
2379Some regular expressions use identical subpatterns in several places.
2380Starting with Perl 5.10, it is possible to define named subpatterns in
2381a section of the pattern so that they can be called up by name
2382anywhere in the pattern. This syntactic pattern for this definition
2383group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion
2384of a named pattern is written as C<(?&name)>.
2385
2386The example below illustrates this feature using the pattern for
2387floating point numbers that was presented earlier on. The three
2388subpatterns that are used more than once are the optional sign, the
2389digit sequence for an integer and the decimal fraction. The DEFINE
2390group at the end of the pattern contains their definition. Notice
2391that the decimal fraction pattern is the first place where we can
2392reuse the integer pattern.
2393
2394 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
2395 (?: [eE](?&osg)(?&int) )?
2396 $
2397 (?(DEFINE)
2398 (?<osg>[-+]?) # optional sign
2399 (?<int>\d++) # integer
2400 (?<dec>\.(?&int)) # decimal fraction
2401 )/x
2402
2403
2404=head2 Recursive patterns
2405
2406This feature (introduced in Perl 5.10) significantly extends the
2407power of Perl's pattern matching. By referring to some other
2408capture group anywhere in the pattern with the construct
2409C<(?group-ref)>, the I<pattern> within the referenced group is used
2410as an independent subpattern in place of the group reference itself.
2411Because the group reference may be contained I<within> the group it
2412refers to, it is now possible to apply pattern matching to tasks that
2413hitherto required a recursive parser.
2414
2415To illustrate this feature, we'll design a pattern that matches if
2416a string contains a palindrome. (This is a word or a sentence that,
2417while ignoring spaces, interpunctuation and case, reads the same backwards
2418as forwards. We begin by observing that the empty string or a string
2419containing just one word character is a palindrome. Otherwise it must
2420have a word character up front and the same at its end, with another
2421palindrome in between.
2422
2423 /(?: (\w) (?...Here be a palindrome...) \{-1} | \w? )/x
2424
2425Adding C<\W*> at either end to eliminate was is to be ignored, we already
2426have the full pattern:
2427
2428 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
2429 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
2430 print "'$s' is a palindrome\n" if $s =~ /$pp/;
2431 }
2432
2433In C<(?...)> both absolute and relative backreferences may be used.
2434The entire pattern can be reinserted with C<(?R)> or C<(?0)>.
2435If you prefer to name your buffers, you can use C<(?&name)> to
2436recurse into that buffer.
2437
2438
47f9c88b
GS
2439=head2 A bit of magic: executing Perl code in a regular expression
2440
2441Normally, regexps are a part of Perl expressions.
7638d2dc 2442I<Code evaluation> expressions turn that around by allowing
da75cd15 2443arbitrary Perl code to be a part of a regexp. A code evaluation
7638d2dc 2444expression is denoted C<(?{code})>, with I<code> a string of Perl
47f9c88b
GS
2445statements.
2446
7638d2dc
WL
2447Be warned that this feature is considered experimental, and may be
2448changed without notice.
2449
47f9c88b
GS
2450Code expressions are zero-width assertions, and the value they return
2451depends on their environment. There are two possibilities: either the
2452code expression is used as a conditional in a conditional expression
2453C<(?(condition)...)>, or it is not. If the code expression is a
2454conditional, the code is evaluated and the result (i.e., the result of
2455the last statement) is used to determine truth or falsehood. If the
2456code expression is not used as a conditional, the assertion always
2457evaluates true and the result is put into the special variable
2458C<$^R>. The variable C<$^R> can then be used in code expressions later
2459in the regexp. Here are some silly examples:
2460
2461 $x = "abcdef";
2462 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2463 # prints 'Hi Mom!'
2464 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2465 # no 'Hi Mom!'
745e1e41
DC
2466
2467Pay careful attention to the next example:
2468
47f9c88b
GS
2469 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2470 # no 'Hi Mom!'
745e1e41
DC
2471 # but why not?
2472
2473At first glance, you'd think that it shouldn't print, because obviously
2474the C<ddd> isn't going to match the target string. But look at this
2475example:
2476
2477 $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
2478 # but _does_ print
2479
2480Hmm. What happened here? If you've been following along, you know that
2481the above pattern should be effectively the same as the last one --
2482enclosing the d in a character class isn't going to change what it
2483matches. So why does the first not print while the second one does?
2484
7638d2dc 2485The answer lies in the optimizations the regex engine makes. In the first
745e1e41
DC
2486case, all the engine sees are plain old characters (aside from the
2487C<?{}> construct). It's smart enough to realize that the string 'ddd'
2488doesn't occur in our target string before actually running the pattern
2489through. But in the second case, we've tricked it into thinking that our
2490pattern is more complicated than it is. It takes a look, sees our
2491character class, and decides that it will have to actually run the
2492pattern to determine whether or not it matches, and in the process of
2493running it hits the print statement before it discovers that we don't
2494have a match.
2495
2496To take a closer look at how the engine does optimizations, see the
2497section L<"Pragmas and debugging"> below.
2498
2499More fun with C<?{}>:
2500
47f9c88b
GS
2501 $x =~ /(?{print "Hi Mom!";})/; # matches,
2502 # prints 'Hi Mom!'
2503 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2504 # prints '1'
2505 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2506 # prints '1'
2507
2508The bit of magic mentioned in the section title occurs when the regexp
2509backtracks in the process of searching for a match. If the regexp
2510backtracks over a code expression and if the variables used within are
2511localized using C<local>, the changes in the variables produced by the
2512code expression are undone! Thus, if we wanted to count how many times
2513a character got matched inside a group, we could use, e.g.,
2514
2515 $x = "aaaa";
2516 $count = 0; # initialize 'a' count
2517 $c = "bob"; # test if $c gets clobbered
2518 $x =~ /(?{local $c = 0;}) # initialize count
2519 ( a # match 'a'
2520 (?{local $c = $c + 1;}) # increment count
2521 )* # do this any number of times,
2522 aa # but match 'aa' at the end
2523 (?{$count = $c;}) # copy local $c var into $count
2524 /x;
2525 print "'a' count is $count, \$c variable is '$c'\n";
2526
2527This prints
2528
2529 'a' count is 2, $c variable is 'bob'
2530
7638d2dc
WL
2531If we replace the S<C< (?{local $c = $c + 1;})>> with
2532S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone
47f9c88b
GS
2533during backtracking, and we get
2534
2535 'a' count is 4, $c variable is 'bob'
2536
2537Note that only localized variable changes are undone. Other side
2538effects of code expression execution are permanent. Thus
2539
2540 $x = "aaaa";
2541 $x =~ /(a(?{print "Yow\n";}))*aa/;
2542
2543produces
2544
2545 Yow
2546 Yow
2547 Yow
2548 Yow
2549
2550The result C<$^R> is automatically localized, so that it will behave
2551properly in the presence of backtracking.
2552
7638d2dc
WL
2553This example uses a code expression in a conditional to match a
2554definite article, either 'the' in English or 'der|die|das' in German:
47f9c88b 2555
47f9c88b
GS
2556 $lang = 'DE'; # use German
2557 ...
2558 $text = "das";
2559 print "matched\n"
2560 if $text =~ /(?(?{
2561 $lang eq 'EN'; # is the language English?
2562 })
2563 the | # if so, then match 'the'
7638d2dc 2564 (der|die|das) # else, match 'der|die|das'
47f9c88b
GS
2565 )
2566 /xi;
2567
2568Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2569C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2570code expression, we don't need the extra parentheses around the
2571conditional.
2572
7638d2dc 2573If you try to use code expressions with interpolating variables, Perl
a6b2f353
GS
2574may surprise you:
2575
2576 $bar = 5;
2577 $pat = '(?{ 1 })';
2578 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
2579 /foo(?{ 1 })$bar/; # compile error!
2580 /foo${pat}bar/; # compile error!
2581
2582 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2583 /foo${pat}bar/; # compiles ok
2584
fa11829f 2585If a regexp has (1) code expressions and interpolating variables, or
7638d2dc 2586(2) a variable that interpolates a code expression, Perl treats the
a6b2f353
GS
2587regexp as an error. If the code expression is precompiled into a
2588variable, however, interpolating is ok. The question is, why is this
2589an error?
2590
2591The reason is that variable interpolation and code expressions
2592together pose a security risk. The combination is dangerous because
2593many programmers who write search engines often take user input and
2594plug it directly into a regexp:
47f9c88b
GS
2595
2596 $regexp = <>; # read user-supplied regexp
2597 $chomp $regexp; # get rid of possible newline
2598 $text =~ /$regexp/; # search $text for the $regexp
2599
a6b2f353
GS
2600If the C<$regexp> variable contains a code expression, the user could
2601then execute arbitrary Perl code. For instance, some joker could
7638d2dc
WL
2602search for S<C<system('rm -rf *');>> to erase your files. In this
2603sense, the combination of interpolation and code expressions I<taints>
47f9c88b 2604your regexp. So by default, using both interpolation and code
a6b2f353
GS
2605expressions in the same regexp is not allowed. If you're not
2606concerned about malicious users, it is possible to bypass this
7638d2dc 2607security check by invoking S<C<use re 'eval'>>:
a6b2f353
GS
2608
2609 use re 'eval'; # throw caution out the door
2610 $bar = 5;
2611 $pat = '(?{ 1 })';
2612 /foo(?{ 1 })$bar/; # compiles ok
2613 /foo${pat}bar/; # compiles ok
47f9c88b 2614
7638d2dc 2615Another form of code expression is the I<pattern code expression>.
47f9c88b
GS
2616The pattern code expression is like a regular code expression, except
2617that the result of the code evaluation is treated as a regular
2618expression and matched immediately. A simple example is
2619
2620 $length = 5;
2621 $char = 'a';
2622 $x = 'aaaaabb';
2623 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2624
2625
2626This final example contains both ordinary and pattern code
7638d2dc 2627expressions. It detects whether a binary string C<1101010010001...> has a
47f9c88b
GS
2628Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2629
47f9c88b 2630 $x = "1101010010001000001";
7638d2dc 2631 $z0 = ''; $z1 = '0'; # initial conditions
47f9c88b
GS
2632 print "It is a Fibonacci sequence\n"
2633 if $x =~ /^1 # match an initial '1'
7638d2dc
WL
2634 (?:
2635 ((??{ $z0 })) # match some '0'
2636 1 # and then a '1'
2637 (?{ $z0 = $z1; $z1 .= $^N; })
47f9c88b
GS
2638 )+ # repeat as needed
2639 $ # that is all there is
2640 /x;
7638d2dc 2641 printf "Largest sequence matched was %d\n", length($z1)-length($z0);
47f9c88b 2642
7638d2dc
WL
2643Remember that C<$^N> is set to whatever was matched by the last
2644completed capture group. This prints
47f9c88b
GS
2645
2646 It is a Fibonacci sequence
2647 Largest sequence matched was 5
2648
2649Ha! Try that with your garden variety regexp package...
2650
7638d2dc 2651Note that the variables C<$z0> and C<$z1> are not substituted when the
47f9c88b 2652regexp is compiled, as happens for ordinary variables outside a code
7638d2dc 2653expression. Rather, the code expressions are evaluated when Perl
47f9c88b
GS
2654encounters them during the search for a match.
2655
2656The regexp without the C<//x> modifier is
2657
7638d2dc
WL
2658 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
2659
2660which shows that spaces are still possible in the code parts. Nevertheless,
2661when working with code and conditional expressions, the extended form of
2662regexps is almost necessary in creating and debugging regexps.
2663
2664
2665=head2 Backtracking control verbs
2666
2667Perl 5.10 introduced a number of control verbs intended to provide
2668detailed control over the backtracking process, by directly influencing
2669the regexp engine and by providing monitoring techniques. As all
2670the features in this group are experimental and subject to change or
2671removal in a future version of Perl, the interested reader is
2672referred to L<perlre/"Special Backtracking Control Verbs"> for a
2673detailed description.
2674
2675Below is just one example, illustrating the control verb C<(*FAIL)>,
2676which may be abbreviated as C<(*F)>. If this is inserted in a regexp
2677it will cause to fail, just like at some mismatch between the pattern
2678and the string. Processing of the regexp continues like after any "normal"
2679failure, so that, for instance, the next position in the string or another
2680alternative will be tried. As failing to match doesn't preserve capture
2681buffers or produce results, it may be necessary to use this in
2682combination with embedded code.
2683
2684 %count = ();
2685 "supercalifragilisticexpialidoceous" =~
2686 /([aeiou])(?{ $count{$1}++; })(*FAIL)/oi;
2687 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
2688
2689The pattern begins with a class matching a subset of letters. Whenever
2690this matches, a statement like C<$count{'a'}++;> is executed, incrementing
2691the letter's counter. Then C<(*FAIL)> does what it says, and
2692the regexp engine proceeds according to the book: as long as the end of
2693the string hasn't been reached, the position is advanced before looking
2694for another vowel. Thus, match or no match makes no difference, and the
2695regexp engine proceeds until the the entire string has been inspected.
2696(It's remarkable that an alternative solution using something like
2697
2698 $count{lc($_)}++ for split('', "supercalifragilisticexpialidoceous");
2699 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
2700
2701is considerably slower.)
47f9c88b 2702
47f9c88b
GS
2703
2704=head2 Pragmas and debugging
2705
2706Speaking of debugging, there are several pragmas available to control
2707and debug regexps in Perl. We have already encountered one pragma in
7638d2dc 2708the previous section, S<C<use re 'eval';>>, that allows variable
a6b2f353
GS
2709interpolation and code expressions to coexist in a regexp. The other
2710pragmas are
47f9c88b
GS
2711
2712 use re 'taint';
2713 $tainted = <>;
2714 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2715
2716The C<taint> pragma causes any substrings from a match with a tainted
2717variable to be tainted as well. This is not normally the case, as
2718regexps are often used to extract the safe bits from a tainted
2719variable. Use C<taint> when you are not extracting safe bits, but are
2720performing some other processing. Both C<taint> and C<eval> pragmas
a6b2f353 2721are lexically scoped, which means they are in effect only until
47f9c88b
GS
2722the end of the block enclosing the pragmas.
2723
2724 use re 'debug';
2725 /^(.*)$/s; # output debugging info
2726
2727 use re 'debugcolor';
2728 /^(.*)$/s; # output debugging info in living color
2729
2730The global C<debug> and C<debugcolor> pragmas allow one to get
2731detailed debugging info about regexp compilation and
2732execution. C<debugcolor> is the same as debug, except the debugging
2733information is displayed in color on terminals that can display
2734termcap color sequences. Here is example output:
2735
2736 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
2737 Compiling REx `a*b+c'
2738 size 9 first at 1
2739 1: STAR(4)
2740 2: EXACT <a>(0)
2741 4: PLUS(7)
2742 5: EXACT <b>(0)
2743 7: EXACT <c>(9)
2744 9: END(0)
2745 floating `bc' at 0..2147483647 (checking floating) minlen 2
2746 Guessing start of match, REx `a*b+c' against `abc'...
2747 Found floating substr `bc' at offset 1...
2748 Guessed: match at offset 0
2749 Matching REx `a*b+c' against `abc'
2750 Setting an EVAL scope, savestack=3
2751 0 <> <abc> | 1: STAR
2752 EXACT <a> can match 1 times out of 32767...
2753 Setting an EVAL scope, savestack=3
2754 1 <a> <bc> | 4: PLUS
2755 EXACT <b> can match 1 times out of 32767...
2756 Setting an EVAL scope, savestack=3
2757 2 <ab> <c> | 7: EXACT <c>
2758 3 <abc> <> | 9: END
2759 Match successful!
2760 Freeing REx: `a*b+c'
2761
2762If you have gotten this far into the tutorial, you can probably guess
2763what the different parts of the debugging output tell you. The first
2764part
2765
2766 Compiling REx `a*b+c'
2767 size 9 first at 1
2768 1: STAR(4)
2769 2: EXACT <a>(0)
2770 4: PLUS(7)
2771 5: EXACT <b>(0)
2772 7: EXACT <c>(9)
2773 9: END(0)
2774
2775describes the compilation stage. C<STAR(4)> means that there is a
2776starred object, in this case C<'a'>, and if it matches, goto line 4,
2777i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2778optimizations performed before a match:
2779
2780 floating `bc' at 0..2147483647 (checking floating) minlen 2
2781 Guessing start of match, REx `a*b+c' against `abc'...
2782 Found floating substr `bc' at offset 1...
2783 Guessed: match at offset 0
2784
2785Then the match is executed and the remaining lines describe the
2786process:
2787
2788 Matching REx `a*b+c' against `abc'
2789 Setting an EVAL scope, savestack=3
2790 0 <> <abc> | 1: STAR
2791 EXACT <a> can match 1 times out of 32767...
2792 Setting an EVAL scope, savestack=3
2793 1 <a> <bc> | 4: PLUS
2794 EXACT <b> can match 1 times out of 32767...
2795 Setting an EVAL scope, savestack=3
2796 2 <ab> <c> | 7: EXACT <c>
2797 3 <abc> <> | 9: END
2798 Match successful!
2799 Freeing REx: `a*b+c'
2800
7638d2dc 2801Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the
47f9c88b 2802part of the string matched and C<< <y> >> the part not yet
7638d2dc 2803matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1
47f9c88b
GS
2804n the compilation list above. See
2805L<perldebguts/"Debugging regular expressions"> for much more detail.
2806
2807An alternative method of debugging regexps is to embed C<print>
2808statements within the regexp. This provides a blow-by-blow account of
2809the backtracking in an alternation:
2810
2811 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2812 t(?{print "t1\n";})
2813 h(?{print "h1\n";})
2814 i(?{print "i1\n";})
2815 s(?{print "s1\n";})
2816 |
2817 t(?{print "t2\n";})
2818 h(?{print "h2\n";})
2819 a(?{print "a2\n";})
2820 t(?{print "t2\n";})
2821 (?{print "Done at position ", pos, "\n";})
2822 @x;
2823
2824prints
2825
2826 Start at position 0
2827 t1
2828 h1
2829 t2
2830 h2
2831 a2
2832 t2
2833 Done at position 4
2834
2835=head1 BUGS
2836
2837Code expressions, conditional expressions, and independent expressions
7638d2dc 2838are I<experimental>. Don't use them in production code. Yet.
47f9c88b
GS
2839
2840=head1 SEE ALSO
2841
7638d2dc 2842This is just a tutorial. For the full story on Perl regular
47f9c88b
GS
2843expressions, see the L<perlre> regular expressions reference page.
2844
2845For more information on the matching C<m//> and substitution C<s///>
2846operators, see L<perlop/"Regexp Quote-Like Operators">. For
2847information on the C<split> operation, see L<perlfunc/split>.
2848
2849For an excellent all-around resource on the care and feeding of
2850regular expressions, see the book I<Mastering Regular Expressions> by
2851Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2852
2853=head1 AUTHOR AND COPYRIGHT
2854
2855Copyright (c) 2000 Mark Kvale
2856All rights reserved.
2857
2858This document may be distributed under the same terms as Perl itself.
2859
2860=head2 Acknowledgments
2861
2862The inspiration for the stop codon DNA example came from the ZIP
2863code example in chapter 7 of I<Mastering Regular Expressions>.
2864
a6b2f353
GS
2865The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2866Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2867comments.
47f9c88b
GS
2868
2869=cut
a6b2f353 2870