This is a live mirror of the Perl 5 development currently hosted at https://github.com/perl/perl5
Documentation corrections from Wallace Reis++.
[perl5.git] / pod / perlretut.pod
CommitLineData
47f9c88b
GS
1=head1 NAME
2
3perlretut - Perl regular expressions tutorial
4
5=head1 DESCRIPTION
6
7This page provides a basic tutorial on understanding, creating and
8using regular expressions in Perl. It serves as a complement to the
9reference page on regular expressions L<perlre>. Regular expressions
10are an integral part of the C<m//>, C<s///>, C<qr//> and C<split>
11operators and so this tutorial also overlaps with
12L<perlop/"Regexp Quote-Like Operators"> and L<perlfunc/split>.
13
14Perl is widely renowned for excellence in text processing, and regular
15expressions are one of the big factors behind this fame. Perl regular
16expressions display an efficiency and flexibility unknown in most
17other computer languages. Mastering even the basics of regular
18expressions will allow you to manipulate text with surprising ease.
19
20What is a regular expression? A regular expression is simply a string
21that describes a pattern. Patterns are in common use these days;
22examples are the patterns typed into a search engine to find web pages
23and the patterns used to list files in a directory, e.g., C<ls *.txt>
24or C<dir *.*>. In Perl, the patterns described by regular expressions
25are used to search strings, extract desired parts of strings, and to
26do search and replace operations.
27
28Regular expressions have the undeserved reputation of being abstract
29and difficult to understand. Regular expressions are constructed using
30simple concepts like conditionals and loops and are no more difficult
31to understand than the corresponding C<if> conditionals and C<while>
32loops in the Perl language itself. In fact, the main challenge in
33learning regular expressions is just getting used to the terse
34notation used to express these concepts.
35
36This tutorial flattens the learning curve by discussing regular
37expression concepts, along with their notation, one at a time and with
38many examples. The first part of the tutorial will progress from the
39simplest word searches to the basic regular expression concepts. If
40you master the first part, you will have all the tools needed to solve
41about 98% of your needs. The second part of the tutorial is for those
42comfortable with the basics and hungry for more power tools. It
43discusses the more advanced regular expression operators and
8ccb1477 44introduces the latest cutting-edge innovations.
47f9c88b
GS
45
46A note: to save time, 'regular expression' is often abbreviated as
47regexp or regex. Regexp is a more natural abbreviation than regex, but
48is harder to pronounce. The Perl pod documentation is evenly split on
49regexp vs regex; in Perl, there is more than one way to abbreviate it.
50We'll use regexp in this tutorial.
51
52=head1 Part 1: The basics
53
54=head2 Simple word matching
55
56The simplest regexp is simply a word, or more generally, a string of
57characters. A regexp consisting of a word matches any string that
58contains that word:
59
60 "Hello World" =~ /World/; # matches
61
7638d2dc 62What is this Perl statement all about? C<"Hello World"> is a simple
8ccb1477 63double-quoted string. C<World> is the regular expression and the
7638d2dc 64C<//> enclosing C</World/> tells Perl to search a string for a match.
47f9c88b
GS
65The operator C<=~> associates the string with the regexp match and
66produces a true value if the regexp matched, or false if the regexp
67did not match. In our case, C<World> matches the second word in
68C<"Hello World">, so the expression is true. Expressions like this
69are useful in conditionals:
70
71 if ("Hello World" =~ /World/) {
72 print "It matches\n";
73 }
74 else {
75 print "It doesn't match\n";
76 }
77
78There are useful variations on this theme. The sense of the match can
7638d2dc 79be reversed by using the C<!~> operator:
47f9c88b
GS
80
81 if ("Hello World" !~ /World/) {
82 print "It doesn't match\n";
83 }
84 else {
85 print "It matches\n";
86 }
87
88The literal string in the regexp can be replaced by a variable:
89
90 $greeting = "World";
91 if ("Hello World" =~ /$greeting/) {
92 print "It matches\n";
93 }
94 else {
95 print "It doesn't match\n";
96 }
97
98If you're matching against the special default variable C<$_>, the
99C<$_ =~> part can be omitted:
100
101 $_ = "Hello World";
102 if (/World/) {
103 print "It matches\n";
104 }
105 else {
106 print "It doesn't match\n";
107 }
108
109And finally, the C<//> default delimiters for a match can be changed
110to arbitrary delimiters by putting an C<'m'> out front:
111
112 "Hello World" =~ m!World!; # matches, delimited by '!'
113 "Hello World" =~ m{World}; # matches, note the matching '{}'
a6b2f353
GS
114 "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
115 # '/' becomes an ordinary char
47f9c88b
GS
116
117C</World/>, C<m!World!>, and C<m{World}> all represent the
7638d2dc
WL
118same thing. When, e.g., the quote (C<">) is used as a delimiter, the forward
119slash C<'/'> becomes an ordinary character and can be used in this regexp
47f9c88b
GS
120without trouble.
121
122Let's consider how different regexps would match C<"Hello World">:
123
124 "Hello World" =~ /world/; # doesn't match
125 "Hello World" =~ /o W/; # matches
126 "Hello World" =~ /oW/; # doesn't match
127 "Hello World" =~ /World /; # doesn't match
128
129The first regexp C<world> doesn't match because regexps are
130case-sensitive. The second regexp matches because the substring
7638d2dc 131S<C<'o W'>> occurs in the string S<C<"Hello World">>. The space
47f9c88b
GS
132character ' ' is treated like any other character in a regexp and is
133needed to match in this case. The lack of a space character is the
134reason the third regexp C<'oW'> doesn't match. The fourth regexp
135C<'World '> doesn't match because there is a space at the end of the
136regexp, but not at the end of the string. The lesson here is that
137regexps must match a part of the string I<exactly> in order for the
138statement to be true.
139
7638d2dc 140If a regexp matches in more than one place in the string, Perl will
47f9c88b
GS
141always match at the earliest possible point in the string:
142
143 "Hello World" =~ /o/; # matches 'o' in 'Hello'
144 "That hat is red" =~ /hat/; # matches 'hat' in 'That'
145
146With respect to character matching, there are a few more points you
147need to know about. First of all, not all characters can be used 'as
7638d2dc 148is' in a match. Some characters, called I<metacharacters>, are reserved
47f9c88b
GS
149for use in regexp notation. The metacharacters are
150
151 {}[]()^$.|*+?\
152
153The significance of each of these will be explained
154in the rest of the tutorial, but for now, it is important only to know
155that a metacharacter can be matched by putting a backslash before it:
156
157 "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
158 "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
159 "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
160 "The interval is [0,1)." =~ /\[0,1\)\./ # matches
7638d2dc 161 "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
47f9c88b
GS
162
163In the last regexp, the forward slash C<'/'> is also backslashed,
164because it is used to delimit the regexp. This can lead to LTS
165(leaning toothpick syndrome), however, and it is often more readable
166to change delimiters.
167
7638d2dc 168 "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
47f9c88b
GS
169
170The backslash character C<'\'> is a metacharacter itself and needs to
171be backslashed:
172
173 'C:\WIN32' =~ /C:\\WIN/; # matches
174
175In addition to the metacharacters, there are some ASCII characters
176which don't have printable character equivalents and are instead
7638d2dc 177represented by I<escape sequences>. Common examples are C<\t> for a
47f9c88b 178tab, C<\n> for a newline, C<\r> for a carriage return and C<\a> for a
43e59f7b 179bell (or alert). If your string is better thought of as a sequence of arbitrary
47f9c88b
GS
180bytes, the octal escape sequence, e.g., C<\033>, or hexadecimal escape
181sequence, e.g., C<\x1B> may be a more natural representation for your
182bytes. Here are some examples of escapes:
183
184 "1000\t2000" =~ m(0\t2) # matches
185 "1000\n2000" =~ /0\n20/ # matches
186 "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
f0a2b745
KW
187 "cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
188 # to spell cat
47f9c88b
GS
189
190If you've been around Perl a while, all this talk of escape sequences
191may seem familiar. Similar escape sequences are used in double-quoted
192strings and in fact the regexps in Perl are mostly treated as
193double-quoted strings. This means that variables can be used in
194regexps as well. Just like double-quoted strings, the values of the
195variables in the regexp will be substituted in before the regexp is
196evaluated for matching purposes. So we have:
197
198 $foo = 'house';
199 'housecat' =~ /$foo/; # matches
200 'cathouse' =~ /cat$foo/; # matches
47f9c88b
GS
201 'housecat' =~ /${foo}cat/; # matches
202
203So far, so good. With the knowledge above you can already perform
204searches with just about any literal string regexp you can dream up.
205Here is a I<very simple> emulation of the Unix grep program:
206
207 % cat > simple_grep
208 #!/usr/bin/perl
209 $regexp = shift;
210 while (<>) {
211 print if /$regexp/;
212 }
213 ^D
214
215 % chmod +x simple_grep
216
217 % simple_grep abba /usr/dict/words
218 Babbage
219 cabbage
220 cabbages
221 sabbath
222 Sabbathize
223 Sabbathizes
224 sabbatical
225 scabbard
226 scabbards
227
228This program is easy to understand. C<#!/usr/bin/perl> is the standard
229way to invoke a perl program from the shell.
7638d2dc 230S<C<$regexp = shift;>> saves the first command line argument as the
47f9c88b 231regexp to be used, leaving the rest of the command line arguments to
7638d2dc
WL
232be treated as files. S<C<< while (<>) >>> loops over all the lines in
233all the files. For each line, S<C<print if /$regexp/;>> prints the
47f9c88b
GS
234line if the regexp matches the line. In this line, both C<print> and
235C</$regexp/> use the default variable C<$_> implicitly.
236
237With all of the regexps above, if the regexp matched anywhere in the
238string, it was considered a match. Sometimes, however, we'd like to
239specify I<where> in the string the regexp should try to match. To do
7638d2dc 240this, we would use the I<anchor> metacharacters C<^> and C<$>. The
47f9c88b
GS
241anchor C<^> means match at the beginning of the string and the anchor
242C<$> means match at the end of the string, or before a newline at the
243end of the string. Here is how they are used:
244
245 "housekeeper" =~ /keeper/; # matches
246 "housekeeper" =~ /^keeper/; # doesn't match
247 "housekeeper" =~ /keeper$/; # matches
248 "housekeeper\n" =~ /keeper$/; # matches
249
250The second regexp doesn't match because C<^> constrains C<keeper> to
251match only at the beginning of the string, but C<"housekeeper"> has
252keeper starting in the middle. The third regexp does match, since the
253C<$> constrains C<keeper> to match only at the end of the string.
254
255When both C<^> and C<$> are used at the same time, the regexp has to
256match both the beginning and the end of the string, i.e., the regexp
257matches the whole string. Consider
258
259 "keeper" =~ /^keep$/; # doesn't match
260 "keeper" =~ /^keeper$/; # matches
261 "" =~ /^$/; # ^$ matches an empty string
262
263The first regexp doesn't match because the string has more to it than
264C<keep>. Since the second regexp is exactly the string, it
265matches. Using both C<^> and C<$> in a regexp forces the complete
266string to match, so it gives you complete control over which strings
267match and which don't. Suppose you are looking for a fellow named
268bert, off in a string by himself:
269
270 "dogbert" =~ /bert/; # matches, but not what you want
271
272 "dilbert" =~ /^bert/; # doesn't match, but ..
273 "bertram" =~ /^bert/; # matches, so still not good enough
274
275 "bertram" =~ /^bert$/; # doesn't match, good
276 "dilbert" =~ /^bert$/; # doesn't match, good
277 "bert" =~ /^bert$/; # matches, perfect
278
279Of course, in the case of a literal string, one could just as easily
7638d2dc 280use the string comparison S<C<$string eq 'bert'>> and it would be
47f9c88b
GS
281more efficient. The C<^...$> regexp really becomes useful when we
282add in the more powerful regexp tools below.
283
284=head2 Using character classes
285
286Although one can already do quite a lot with the literal string
287regexps above, we've only scratched the surface of regular expression
288technology. In this and subsequent sections we will introduce regexp
289concepts (and associated metacharacter notations) that will allow a
8ccb1477 290regexp to represent not just a single character sequence, but a I<whole
47f9c88b
GS
291class> of them.
292
7638d2dc 293One such concept is that of a I<character class>. A character class
47f9c88b
GS
294allows a set of possible characters, rather than just a single
295character, to match at a particular point in a regexp. Character
296classes are denoted by brackets C<[...]>, with the set of characters
297to be possibly matched inside. Here are some examples:
298
299 /cat/; # matches 'cat'
300 /[bcr]at/; # matches 'bat, 'cat', or 'rat'
301 /item[0123456789]/; # matches 'item0' or ... or 'item9'
a6b2f353 302 "abc" =~ /[cab]/; # matches 'a'
47f9c88b
GS
303
304In the last statement, even though C<'c'> is the first character in
305the class, C<'a'> matches because the first character position in the
306string is the earliest point at which the regexp can match.
307
308 /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
309 # 'yes', 'Yes', 'YES', etc.
310
da75cd15 311This regexp displays a common task: perform a case-insensitive
28c3722c 312match. Perl provides a way of avoiding all those brackets by simply
47f9c88b
GS
313appending an C<'i'> to the end of the match. Then C</[yY][eE][sS]/;>
314can be rewritten as C</yes/i;>. The C<'i'> stands for
7638d2dc 315case-insensitive and is an example of a I<modifier> of the matching
47f9c88b
GS
316operation. We will meet other modifiers later in the tutorial.
317
318We saw in the section above that there were ordinary characters, which
319represented themselves, and special characters, which needed a
320backslash C<\> to represent themselves. The same is true in a
321character class, but the sets of ordinary and special characters
322inside a character class are different than those outside a character
7638d2dc 323class. The special characters for a character class are C<-]\^$> (and
353c6505 324the pattern delimiter, whatever it is).
7638d2dc 325C<]> is special because it denotes the end of a character class. C<$> is
47f9c88b
GS
326special because it denotes a scalar variable. C<\> is special because
327it is used in escape sequences, just like above. Here is how the
328special characters C<]$\> are handled:
329
330 /[\]c]def/; # matches ']def' or 'cdef'
331 $x = 'bcr';
a6b2f353 332 /[$x]at/; # matches 'bat', 'cat', or 'rat'
47f9c88b
GS
333 /[\$x]at/; # matches '$at' or 'xat'
334 /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
335
353c6505 336The last two are a little tricky. In C<[\$x]>, the backslash protects
47f9c88b
GS
337the dollar sign, so the character class has two members C<$> and C<x>.
338In C<[\\$x]>, the backslash is protected, so C<$x> is treated as a
339variable and substituted in double quote fashion.
340
341The special character C<'-'> acts as a range operator within character
342classes, so that a contiguous set of characters can be written as a
343range. With ranges, the unwieldy C<[0123456789]> and C<[abc...xyz]>
344become the svelte C<[0-9]> and C<[a-z]>. Some examples are
345
346 /item[0-9]/; # matches 'item0' or ... or 'item9'
347 /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
348 # 'baa', 'xaa', 'yaa', or 'zaa'
349 /[0-9a-fA-F]/; # matches a hexadecimal digit
36bbe248 350 /[0-9a-zA-Z_]/; # matches a "word" character,
7638d2dc 351 # like those in a Perl variable name
47f9c88b
GS
352
353If C<'-'> is the first or last character in a character class, it is
354treated as an ordinary character; C<[-ab]>, C<[ab-]> and C<[a\-b]> are
355all equivalent.
356
357The special character C<^> in the first position of a character class
7638d2dc 358denotes a I<negated character class>, which matches any character but
a6b2f353 359those in the brackets. Both C<[...]> and C<[^...]> must match a
47f9c88b
GS
360character, or the match fails. Then
361
362 /[^a]at/; # doesn't match 'aat' or 'at', but matches
363 # all other 'bat', 'cat, '0at', '%at', etc.
364 /[^0-9]/; # matches a non-numeric character
365 /[a^]at/; # matches 'aat' or '^at'; here '^' is ordinary
366
28c3722c 367Now, even C<[0-9]> can be a bother to write multiple times, so in the
47f9c88b 368interest of saving keystrokes and making regexps more readable, Perl
7638d2dc 369has several abbreviations for common character classes, as shown below.
0bd5a82d
KW
370Since the introduction of Unicode, unless the C<//a> modifier is in
371effect, these character classes match more than just a few characters in
372the ASCII range.
47f9c88b
GS
373
374=over 4
375
376=item *
551e1d92 377
7638d2dc 378\d matches a digit, not just [0-9] but also digits from non-roman scripts
47f9c88b
GS
379
380=item *
551e1d92 381
7638d2dc 382\s matches a whitespace character, the set [\ \t\r\n\f] and others
47f9c88b
GS
383
384=item *
551e1d92 385
7638d2dc
WL
386\w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]
387but also digits and characters from non-roman scripts
47f9c88b
GS
388
389=item *
551e1d92 390
7638d2dc 391\D is a negated \d; it represents any other character than a digit, or [^\d]
47f9c88b
GS
392
393=item *
551e1d92 394
47f9c88b
GS
395\S is a negated \s; it represents any non-whitespace character [^\s]
396
397=item *
551e1d92 398
47f9c88b
GS
399\W is a negated \w; it represents any non-word character [^\w]
400
401=item *
551e1d92 402
7638d2dc
WL
403The period '.' matches any character but "\n" (unless the modifier C<//s> is
404in effect, as explained below).
47f9c88b 405
1ca4ba9b
KW
406=item *
407
408\N, like the period, matches any character but "\n", but it does so
409regardless of whether the modifier C<//s> is in effect.
410
47f9c88b
GS
411=back
412
0bd5a82d
KW
413The C<//a> modifier, available starting in Perl 5.14, is used to
414restrict the matches of \d, \s, and \w to just those in the ASCII range.
415It is useful to keep your program from being needlessly exposed to full
416Unicode (and its accompanying security considerations) when all you want
417is to process English-like text. (The "a" may be doubled, C<//aa>, to
418provide even more restrictions, preventing case-insensitive matching of
419ASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign"
420would caselessly match a "k" or "K".)
421
47f9c88b
GS
422The C<\d\s\w\D\S\W> abbreviations can be used both inside and outside
423of character classes. Here are some in use:
424
425 /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
426 /[\d\s]/; # matches any digit or whitespace character
427 /\w\W\w/; # matches a word char, followed by a
428 # non-word char, followed by a word char
429 /..rt/; # matches any two chars, followed by 'rt'
430 /end\./; # matches 'end.'
431 /end[.]/; # same thing, matches 'end.'
432
433Because a period is a metacharacter, it needs to be escaped to match
434as an ordinary period. Because, for example, C<\d> and C<\w> are sets
435of characters, it is incorrect to think of C<[^\d\w]> as C<[\D\W]>; in
436fact C<[^\d\w]> is the same as C<[^\w]>, which is the same as
437C<[\W]>. Think DeMorgan's laws.
438
7638d2dc 439An anchor useful in basic regexps is the I<word anchor>
47f9c88b
GS
440C<\b>. This matches a boundary between a word character and a non-word
441character C<\w\W> or C<\W\w>:
442
443 $x = "Housecat catenates house and cat";
444 $x =~ /cat/; # matches cat in 'housecat'
445 $x =~ /\bcat/; # matches cat in 'catenates'
446 $x =~ /cat\b/; # matches cat in 'housecat'
447 $x =~ /\bcat\b/; # matches 'cat' at end of string
448
449Note in the last example, the end of the string is considered a word
450boundary.
451
452You might wonder why C<'.'> matches everything but C<"\n"> - why not
453every character? The reason is that often one is matching against
454lines and would like to ignore the newline characters. For instance,
455while the string C<"\n"> represents one line, we would like to think
28c3722c 456of it as empty. Then
47f9c88b
GS
457
458 "" =~ /^$/; # matches
7638d2dc 459 "\n" =~ /^$/; # matches, $ anchors before "\n"
47f9c88b
GS
460
461 "" =~ /./; # doesn't match; it needs a char
462 "" =~ /^.$/; # doesn't match; it needs a char
463 "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
464 "a" =~ /^.$/; # matches
7638d2dc 465 "a\n" =~ /^.$/; # matches, $ anchors before "\n"
47f9c88b
GS
466
467This behavior is convenient, because we usually want to ignore
468newlines when we count and match characters in a line. Sometimes,
469however, we want to keep track of newlines. We might even want C<^>
470and C<$> to anchor at the beginning and end of lines within the
471string, rather than just the beginning and end of the string. Perl
472allows us to choose between ignoring and paying attention to newlines
473by using the C<//s> and C<//m> modifiers. C<//s> and C<//m> stand for
474single line and multi-line and they determine whether a string is to
475be treated as one continuous string, or as a set of lines. The two
476modifiers affect two aspects of how the regexp is interpreted: 1) how
477the C<'.'> character class is defined, and 2) where the anchors C<^>
478and C<$> are able to match. Here are the four possible combinations:
479
480=over 4
481
482=item *
551e1d92 483
47f9c88b
GS
484no modifiers (//): Default behavior. C<'.'> matches any character
485except C<"\n">. C<^> matches only at the beginning of the string and
486C<$> matches only at the end or before a newline at the end.
487
488=item *
551e1d92 489
47f9c88b
GS
490s modifier (//s): Treat string as a single long line. C<'.'> matches
491any character, even C<"\n">. C<^> matches only at the beginning of
492the string and C<$> matches only at the end or before a newline at the
493end.
494
495=item *
551e1d92 496
47f9c88b
GS
497m modifier (//m): Treat string as a set of multiple lines. C<'.'>
498matches any character except C<"\n">. C<^> and C<$> are able to match
499at the start or end of I<any> line within the string.
500
501=item *
551e1d92 502
47f9c88b
GS
503both s and m modifiers (//sm): Treat string as a single long line, but
504detect multiple lines. C<'.'> matches any character, even
505C<"\n">. C<^> and C<$>, however, are able to match at the start or end
506of I<any> line within the string.
507
508=back
509
510Here are examples of C<//s> and C<//m> in action:
511
512 $x = "There once was a girl\nWho programmed in Perl\n";
513
514 $x =~ /^Who/; # doesn't match, "Who" not at start of string
515 $x =~ /^Who/s; # doesn't match, "Who" not at start of string
516 $x =~ /^Who/m; # matches, "Who" at start of second line
517 $x =~ /^Who/sm; # matches, "Who" at start of second line
518
519 $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
520 $x =~ /girl.Who/s; # matches, "." matches "\n"
521 $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
522 $x =~ /girl.Who/sm; # matches, "." matches "\n"
523
3c12f9b9 524Most of the time, the default behavior is what is wanted, but C<//s> and
47f9c88b 525C<//m> are occasionally very useful. If C<//m> is being used, the start
28c3722c 526of the string can still be matched with C<\A> and the end of the string
47f9c88b
GS
527can still be matched with the anchors C<\Z> (matches both the end and
528the newline before, like C<$>), and C<\z> (matches only the end):
529
530 $x =~ /^Who/m; # matches, "Who" at start of second line
531 $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
532
533 $x =~ /girl$/m; # matches, "girl" at end of first line
534 $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
535
536 $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
537 $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
538
539We now know how to create choices among classes of characters in a
540regexp. What about choices among words or character strings? Such
541choices are described in the next section.
542
543=head2 Matching this or that
544
28c3722c 545Sometimes we would like our regexp to be able to match different
47f9c88b 546possible words or character strings. This is accomplished by using
7638d2dc
WL
547the I<alternation> metacharacter C<|>. To match C<dog> or C<cat>, we
548form the regexp C<dog|cat>. As before, Perl will try to match the
47f9c88b 549regexp at the earliest possible point in the string. At each
7638d2dc
WL
550character position, Perl will first try to match the first
551alternative, C<dog>. If C<dog> doesn't match, Perl will then try the
47f9c88b 552next alternative, C<cat>. If C<cat> doesn't match either, then the
7638d2dc 553match fails and Perl moves to the next position in the string. Some
47f9c88b
GS
554examples:
555
556 "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
557 "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
558
559Even though C<dog> is the first alternative in the second regexp,
560C<cat> is able to match earlier in the string.
561
562 "cats" =~ /c|ca|cat|cats/; # matches "c"
563 "cats" =~ /cats|cat|ca|c/; # matches "cats"
564
565Here, all the alternatives match at the first string position, so the
566first alternative is the one that matches. If some of the
567alternatives are truncations of the others, put the longest ones first
568to give them a chance to match.
569
570 "cab" =~ /a|b|c/ # matches "c"
571 # /a|b|c/ == /[abc]/
572
573The last example points out that character classes are like
574alternations of characters. At a given character position, the first
210b36aa 575alternative that allows the regexp match to succeed will be the one
47f9c88b
GS
576that matches.
577
578=head2 Grouping things and hierarchical matching
579
580Alternation allows a regexp to choose among alternatives, but by
7638d2dc 581itself it is unsatisfying. The reason is that each alternative is a whole
47f9c88b
GS
582regexp, but sometime we want alternatives for just part of a
583regexp. For instance, suppose we want to search for housecats or
584housekeepers. The regexp C<housecat|housekeeper> fits the bill, but is
585inefficient because we had to type C<house> twice. It would be nice to
da75cd15 586have parts of the regexp be constant, like C<house>, and some
47f9c88b
GS
587parts have alternatives, like C<cat|keeper>.
588
7638d2dc 589The I<grouping> metacharacters C<()> solve this problem. Grouping
47f9c88b
GS
590allows parts of a regexp to be treated as a single unit. Parts of a
591regexp are grouped by enclosing them in parentheses. Thus we could solve
592the C<housecat|housekeeper> by forming the regexp as
593C<house(cat|keeper)>. The regexp C<house(cat|keeper)> means match
594C<house> followed by either C<cat> or C<keeper>. Some more examples
595are
596
597 /(a|b)b/; # matches 'ab' or 'bb'
598 /(ac|b)b/; # matches 'acb' or 'bb'
599 /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
600 /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
601
602 /house(cat|)/; # matches either 'housecat' or 'house'
603 /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
604 # 'house'. Note groups can be nested.
605
606 /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
607 "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
608 # because '20\d\d' can't match
609
610Alternations behave the same way in groups as out of them: at a given
611string position, the leftmost alternative that allows the regexp to
210b36aa 612match is taken. So in the last example at the first string position,
47f9c88b 613C<"20"> matches the second alternative, but there is nothing left over
7638d2dc 614to match the next two digits C<\d\d>. So Perl moves on to the next
47f9c88b
GS
615alternative, which is the null alternative and that works, since
616C<"20"> is two digits.
617
618The process of trying one alternative, seeing if it matches, and
7638d2dc
WL
619moving on to the next alternative, while going back in the string
620from where the previous alternative was tried, if it doesn't, is called
621I<backtracking>. The term 'backtracking' comes from the idea that
47f9c88b
GS
622matching a regexp is like a walk in the woods. Successfully matching
623a regexp is like arriving at a destination. There are many possible
624trailheads, one for each string position, and each one is tried in
625order, left to right. From each trailhead there may be many paths,
626some of which get you there, and some which are dead ends. When you
627walk along a trail and hit a dead end, you have to backtrack along the
628trail to an earlier point to try another trail. If you hit your
629destination, you stop immediately and forget about trying all the
630other trails. You are persistent, and only if you have tried all the
631trails from all the trailheads and not arrived at your destination, do
632you declare failure. To be concrete, here is a step-by-step analysis
7638d2dc 633of what Perl does when it tries to match the regexp
47f9c88b
GS
634
635 "abcde" =~ /(abd|abc)(df|d|de)/;
636
637=over 4
638
551e1d92
RB
639=item 0
640
641Start with the first letter in the string 'a'.
642
643=item 1
47f9c88b 644
551e1d92 645Try the first alternative in the first group 'abd'.
47f9c88b 646
551e1d92 647=item 2
47f9c88b 648
551e1d92
RB
649Match 'a' followed by 'b'. So far so good.
650
651=item 3
652
653'd' in the regexp doesn't match 'c' in the string - a dead
47f9c88b
GS
654end. So backtrack two characters and pick the second alternative in
655the first group 'abc'.
656
551e1d92
RB
657=item 4
658
659Match 'a' followed by 'b' followed by 'c'. We are on a roll
47f9c88b
GS
660and have satisfied the first group. Set $1 to 'abc'.
661
551e1d92
RB
662=item 5
663
664Move on to the second group and pick the first alternative
47f9c88b
GS
665'df'.
666
551e1d92 667=item 6
47f9c88b 668
551e1d92
RB
669Match the 'd'.
670
671=item 7
672
673'f' in the regexp doesn't match 'e' in the string, so a dead
47f9c88b
GS
674end. Backtrack one character and pick the second alternative in the
675second group 'd'.
676
551e1d92
RB
677=item 8
678
679'd' matches. The second grouping is satisfied, so set $2 to
47f9c88b
GS
680'd'.
681
551e1d92
RB
682=item 9
683
684We are at the end of the regexp, so we are done! We have
47f9c88b
GS
685matched 'abcd' out of the string "abcde".
686
687=back
688
689There are a couple of things to note about this analysis. First, the
690third alternative in the second group 'de' also allows a match, but we
691stopped before we got to it - at a given character position, leftmost
692wins. Second, we were able to get a match at the first character
693position of the string 'a'. If there were no matches at the first
7638d2dc 694position, Perl would move to the second character position 'b' and
47f9c88b 695attempt the match all over again. Only when all possible paths at all
7638d2dc
WL
696possible character positions have been exhausted does Perl give
697up and declare S<C<$string =~ /(abd|abc)(df|d|de)/;>> to be false.
47f9c88b
GS
698
699Even with all this work, regexp matching happens remarkably fast. To
353c6505
DL
700speed things up, Perl compiles the regexp into a compact sequence of
701opcodes that can often fit inside a processor cache. When the code is
7638d2dc
WL
702executed, these opcodes can then run at full throttle and search very
703quickly.
47f9c88b
GS
704
705=head2 Extracting matches
706
707The grouping metacharacters C<()> also serve another completely
708different function: they allow the extraction of the parts of a string
709that matched. This is very useful to find out what matched and for
710text processing in general. For each grouping, the part that matched
711inside goes into the special variables C<$1>, C<$2>, etc. They can be
712used just as ordinary variables:
713
714 # extract hours, minutes, seconds
2275acdc
RGS
715 if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
716 $hours = $1;
717 $minutes = $2;
718 $seconds = $3;
719 }
47f9c88b
GS
720
721Now, we know that in scalar context,
7638d2dc 722S<C<$time =~ /(\d\d):(\d\d):(\d\d)/>> returns a true or false
47f9c88b
GS
723value. In list context, however, it returns the list of matched values
724C<($1,$2,$3)>. So we could write the code more compactly as
725
726 # extract hours, minutes, seconds
727 ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
728
729If the groupings in a regexp are nested, C<$1> gets the group with the
730leftmost opening parenthesis, C<$2> the next opening parenthesis,
7638d2dc 731etc. Here is a regexp with nested groups:
47f9c88b
GS
732
733 /(ab(cd|ef)((gi)|j))/;
734 1 2 34
735
7638d2dc
WL
736If this regexp matches, C<$1> contains a string starting with
737C<'ab'>, C<$2> is either set to C<'cd'> or C<'ef'>, C<$3> equals either
738C<'gi'> or C<'j'>, and C<$4> is either set to C<'gi'>, just like C<$3>,
739or it remains undefined.
740
741For convenience, Perl sets C<$+> to the string held by the highest numbered
742C<$1>, C<$2>,... that got assigned (and, somewhat related, C<$^N> to the
743value of the C<$1>, C<$2>,... most-recently assigned; i.e. the C<$1>,
744C<$2>,... associated with the rightmost closing parenthesis used in the
a01268b5 745match).
47f9c88b 746
7638d2dc
WL
747
748=head2 Backreferences
749
47f9c88b 750Closely associated with the matching variables C<$1>, C<$2>, ... are
d8b950dc 751the I<backreferences> C<\g1>, C<\g2>,... Backreferences are simply
47f9c88b 752matching variables that can be used I<inside> a regexp. This is a
ac036724 753really nice feature; what matches later in a regexp is made to depend on
47f9c88b 754what matched earlier in the regexp. Suppose we wanted to look
7638d2dc 755for doubled words in a text, like 'the the'. The following regexp finds
47f9c88b
GS
756all 3-letter doubles with a space in between:
757
d8b950dc 758 /\b(\w\w\w)\s\g1\b/;
47f9c88b 759
8ccb1477 760The grouping assigns a value to \g1, so that the same 3-letter sequence
7638d2dc
WL
761is used for both parts.
762
763A similar task is to find words consisting of two identical parts:
47f9c88b 764
d8b950dc 765 % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
47f9c88b
GS
766 beriberi
767 booboo
768 coco
769 mama
770 murmur
771 papa
772
773The regexp has a single grouping which considers 4-letter
d8b950dc
KW
774combinations, then 3-letter combinations, etc., and uses C<\g1> to look for
775a repeat. Although C<$1> and C<\g1> represent the same thing, care should be
7638d2dc 776taken to use matched variables C<$1>, C<$2>,... only I<outside> a regexp
d8b950dc 777and backreferences C<\g1>, C<\g2>,... only I<inside> a regexp; not doing
7638d2dc
WL
778so may lead to surprising and unsatisfactory results.
779
780
781=head2 Relative backreferences
782
783Counting the opening parentheses to get the correct number for a
7698aede 784backreference is error-prone as soon as there is more than one
7638d2dc
WL
785capturing group. A more convenient technique became available
786with Perl 5.10: relative backreferences. To refer to the immediately
787preceding capture group one now may write C<\g{-1}>, the next but
788last is available via C<\g{-2}>, and so on.
789
790Another good reason in addition to readability and maintainability
8ccb1477 791for using relative backreferences is illustrated by the following example,
7638d2dc
WL
792where a simple pattern for matching peculiar strings is used:
793
d8b950dc 794 $a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.
7638d2dc
WL
795
796Now that we have this pattern stored as a handy string, we might feel
797tempted to use it as a part of some other pattern:
798
799 $line = "code=e99e";
800 if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
801 print "$1 is valid\n";
802 } else {
803 print "bad line: '$line'\n";
804 }
805
ac036724 806But this doesn't match, at least not the way one might expect. Only
7638d2dc
WL
807after inserting the interpolated C<$a99a> and looking at the resulting
808full text of the regexp is it obvious that the backreferences have
ac036724 809backfired. The subexpression C<(\w+)> has snatched number 1 and
7638d2dc
WL
810demoted the groups in C<$a99a> by one rank. This can be avoided by
811using relative backreferences:
812
813 $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
814
815
816=head2 Named backreferences
817
c27a5cfe 818Perl 5.10 also introduced named capture groups and named backreferences.
7638d2dc
WL
819To attach a name to a capturing group, you write either
820C<< (?<name>...) >> or C<< (?'name'...) >>. The backreference may
821then be written as C<\g{name}>. It is permissible to attach the
822same name to more than one group, but then only the leftmost one of the
823eponymous set can be referenced. Outside of the pattern a named
c27a5cfe 824capture group is accessible through the C<%+> hash.
7638d2dc 825
353c6505 826Assuming that we have to match calendar dates which may be given in one
7638d2dc 827of the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can write
353c6505 828three suitable patterns where we use 'd', 'm' and 'y' respectively as the
c27a5cfe 829names of the groups capturing the pertaining components of a date. The
7638d2dc
WL
830matching operation combines the three patterns as alternatives:
831
832 $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
833 $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
834 $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
835 for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
836 if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
837 print "day=$+{d} month=$+{m} year=$+{y}\n";
838 }
839 }
840
841If any of the alternatives matches, the hash C<%+> is bound to contain the
842three key-value pairs.
843
844
845=head2 Alternative capture group numbering
846
847Yet another capturing group numbering technique (also as from Perl 5.10)
848deals with the problem of referring to groups within a set of alternatives.
849Consider a pattern for matching a time of the day, civil or military style:
47f9c88b 850
7638d2dc
WL
851 if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
852 # process hour and minute
853 }
854
855Processing the results requires an additional if statement to determine
353c6505 856whether C<$1> and C<$2> or C<$3> and C<$4> contain the goodies. It would
c27a5cfe 857be easier if we could use group numbers 1 and 2 in second alternative as
353c6505 858well, and this is exactly what the parenthesized construct C<(?|...)>,
7638d2dc
WL
859set around an alternative achieves. Here is an extended version of the
860previous pattern:
861
862 if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
863 print "hour=$1 minute=$2 zone=$3\n";
864 }
865
c27a5cfe 866Within the alternative numbering group, group numbers start at the same
7638d2dc 867position for each alternative. After the group, numbering continues
353c6505 868with one higher than the maximum reached across all the alternatives.
7638d2dc
WL
869
870=head2 Position information
871
13e5d9cd 872In addition to what was matched, Perl also provides the
7638d2dc 873positions of what was matched as contents of the C<@-> and C<@+>
47f9c88b
GS
874arrays. C<$-[0]> is the position of the start of the entire match and
875C<$+[0]> is the position of the end. Similarly, C<$-[n]> is the
876position of the start of the C<$n> match and C<$+[n]> is the position
877of the end. If C<$n> is undefined, so are C<$-[n]> and C<$+[n]>. Then
878this code
879
880 $x = "Mmm...donut, thought Homer";
881 $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
882 foreach $expr (1..$#-) {
883 print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
884 }
885
886prints
887
888 Match 1: 'Mmm' at position (0,3)
889 Match 2: 'donut' at position (6,11)
890
891Even if there are no groupings in a regexp, it is still possible to
7638d2dc 892find out what exactly matched in a string. If you use them, Perl
47f9c88b
GS
893will set C<$`> to the part of the string before the match, will set C<$&>
894to the part of the string that matched, and will set C<$'> to the part
895of the string after the match. An example:
896
897 $x = "the cat caught the mouse";
898 $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
899 $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
900
7638d2dc
WL
901In the second match, C<$`> equals C<''> because the regexp matched at the
902first character position in the string and stopped; it never saw the
13b0f67d
DM
903second 'the'.
904
905If your code is to run on Perl versions earlier than
9065.20, it is worthwhile to note that using C<$`> and C<$'>
7638d2dc 907slows down regexp matching quite a bit, while C<$&> slows it down to a
47f9c88b 908lesser extent, because if they are used in one regexp in a program,
7638d2dc 909they are generated for I<all> regexps in the program. So if raw
47f9c88b 910performance is a goal of your application, they should be avoided.
7638d2dc
WL
911If you need to extract the corresponding substrings, use C<@-> and
912C<@+> instead:
47f9c88b
GS
913
914 $` is the same as substr( $x, 0, $-[0] )
915 $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
916 $' is the same as substr( $x, $+[0] )
917
78622607 918As of Perl 5.10, the C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}>
13b0f67d
DM
919variables may be used. These are only set if the C</p> modifier is
920present. Consequently they do not penalize the rest of the program. In
921Perl 5.20, C<${^PREMATCH}>, C<${^MATCH}> and C<${^POSTMATCH}> are available
922whether the C</p> has been used or not (the modifier is ignored), and
923C<$`>, C<$'> and C<$&> do not cause any speed difference.
7638d2dc
WL
924
925=head2 Non-capturing groupings
926
353c6505 927A group that is required to bundle a set of alternatives may or may not be
7638d2dc 928useful as a capturing group. If it isn't, it just creates a superfluous
c27a5cfe 929addition to the set of available capture group values, inside as well as
7638d2dc 930outside the regexp. Non-capturing groupings, denoted by C<(?:regexp)>,
353c6505 931still allow the regexp to be treated as a single unit, but don't establish
c27a5cfe 932a capturing group at the same time. Both capturing and non-capturing
7638d2dc
WL
933groupings are allowed to co-exist in the same regexp. Because there is
934no extraction, non-capturing groupings are faster than capturing
935groupings. Non-capturing groupings are also handy for choosing exactly
936which parts of a regexp are to be extracted to matching variables:
937
938 # match a number, $1-$4 are set, but we only want $1
939 /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
940
941 # match a number faster , only $1 is set
942 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
943
944 # match a number, get $1 = whole number, $2 = exponent
945 /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
946
947Non-capturing groupings are also useful for removing nuisance
948elements gathered from a split operation where parentheses are
949required for some reason:
950
951 $x = '12aba34ba5';
9b846e30 952 @num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
7638d2dc
WL
953 @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
954
955
47f9c88b
GS
956=head2 Matching repetitions
957
958The examples in the previous section display an annoying weakness. We
7638d2dc
WL
959were only matching 3-letter words, or chunks of words of 4 letters or
960less. We'd like to be able to match words or, more generally, strings
961of any length, without writing out tedious alternatives like
47f9c88b
GS
962C<\w\w\w\w|\w\w\w|\w\w|\w>.
963
7638d2dc
WL
964This is exactly the problem the I<quantifier> metacharacters C<?>,
965C<*>, C<+>, and C<{}> were created for. They allow us to delimit the
966number of repeats for a portion of a regexp we consider to be a
47f9c88b
GS
967match. Quantifiers are put immediately after the character, character
968class, or grouping that we want to specify. They have the following
969meanings:
970
971=over 4
972
551e1d92 973=item *
47f9c88b 974
7638d2dc 975C<a?> means: match 'a' 1 or 0 times
47f9c88b 976
551e1d92
RB
977=item *
978
7638d2dc 979C<a*> means: match 'a' 0 or more times, i.e., any number of times
551e1d92
RB
980
981=item *
47f9c88b 982
7638d2dc 983C<a+> means: match 'a' 1 or more times, i.e., at least once
551e1d92
RB
984
985=item *
986
7638d2dc 987C<a{n,m}> means: match at least C<n> times, but not more than C<m>
47f9c88b
GS
988times.
989
551e1d92
RB
990=item *
991
7638d2dc 992C<a{n,}> means: match at least C<n> or more times
551e1d92
RB
993
994=item *
47f9c88b 995
7638d2dc 996C<a{n}> means: match exactly C<n> times
47f9c88b
GS
997
998=back
999
1000Here are some examples:
1001
7638d2dc 1002 /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
47f9c88b 1003 # any number of digits
d8b950dc 1004 /(\w+)\s+\g1/; # match doubled words of arbitrary length
47f9c88b 1005 /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
c2ac8995
NS
1006 $year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
1007 # than 4 digits
f5b885cd 1008 $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
c2ac8995
NS
1009 $year =~ /^\d{2}(\d{2})?$/; # same thing written differently. However,
1010 # this captures the last two digits in $1
1011 # and the other does not.
47f9c88b 1012
d8b950dc 1013 % simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
47f9c88b
GS
1014 beriberi
1015 booboo
1016 coco
1017 mama
1018 murmur
1019 papa
1020
7638d2dc 1021For all of these quantifiers, Perl will try to match as much of the
47f9c88b 1022string as possible, while still allowing the regexp to succeed. Thus
7638d2dc
WL
1023with C</a?.../>, Perl will first try to match the regexp with the C<a>
1024present; if that fails, Perl will try to match the regexp without the
47f9c88b
GS
1025C<a> present. For the quantifier C<*>, we get the following:
1026
1027 $x = "the cat in the hat";
1028 $x =~ /^(.*)(cat)(.*)$/; # matches,
1029 # $1 = 'the '
1030 # $2 = 'cat'
1031 # $3 = ' in the hat'
1032
1033Which is what we might expect, the match finds the only C<cat> in the
1034string and locks onto it. Consider, however, this regexp:
1035
1036 $x =~ /^(.*)(at)(.*)$/; # matches,
1037 # $1 = 'the cat in the h'
1038 # $2 = 'at'
7638d2dc 1039 # $3 = '' (0 characters match)
47f9c88b 1040
7638d2dc 1041One might initially guess that Perl would find the C<at> in C<cat> and
47f9c88b
GS
1042stop there, but that wouldn't give the longest possible string to the
1043first quantifier C<.*>. Instead, the first quantifier C<.*> grabs as
1044much of the string as possible while still having the regexp match. In
a6b2f353 1045this example, that means having the C<at> sequence with the final C<at>
f5b885cd 1046in the string. The other important principle illustrated here is that,
47f9c88b 1047when there are two or more elements in a regexp, the I<leftmost>
f5b885cd 1048quantifier, if there is one, gets to grab as much of the string as
47f9c88b
GS
1049possible, leaving the rest of the regexp to fight over scraps. Thus in
1050our example, the first quantifier C<.*> grabs most of the string, while
1051the second quantifier C<.*> gets the empty string. Quantifiers that
7638d2dc
WL
1052grab as much of the string as possible are called I<maximal match> or
1053I<greedy> quantifiers.
47f9c88b
GS
1054
1055When a regexp can match a string in several different ways, we can use
1056the principles above to predict which way the regexp will match:
1057
1058=over 4
1059
1060=item *
551e1d92 1061
47f9c88b
GS
1062Principle 0: Taken as a whole, any regexp will be matched at the
1063earliest possible position in the string.
1064
1065=item *
551e1d92 1066
47f9c88b
GS
1067Principle 1: In an alternation C<a|b|c...>, the leftmost alternative
1068that allows a match for the whole regexp will be the one used.
1069
1070=item *
551e1d92 1071
47f9c88b
GS
1072Principle 2: The maximal matching quantifiers C<?>, C<*>, C<+> and
1073C<{n,m}> will in general match as much of the string as possible while
1074still allowing the whole regexp to match.
1075
1076=item *
551e1d92 1077
47f9c88b
GS
1078Principle 3: If there are two or more elements in a regexp, the
1079leftmost greedy quantifier, if any, will match as much of the string
1080as possible while still allowing the whole regexp to match. The next
1081leftmost greedy quantifier, if any, will try to match as much of the
1082string remaining available to it as possible, while still allowing the
1083whole regexp to match. And so on, until all the regexp elements are
1084satisfied.
1085
1086=back
1087
ac036724 1088As we have seen above, Principle 0 overrides the others. The regexp
47f9c88b
GS
1089will be matched as early as possible, with the other principles
1090determining how the regexp matches at that earliest character
1091position.
1092
1093Here is an example of these principles in action:
1094
1095 $x = "The programming republic of Perl";
1096 $x =~ /^(.+)(e|r)(.*)$/; # matches,
1097 # $1 = 'The programming republic of Pe'
1098 # $2 = 'r'
1099 # $3 = 'l'
1100
1101This regexp matches at the earliest string position, C<'T'>. One
1102might think that C<e>, being leftmost in the alternation, would be
1103matched, but C<r> produces the longest string in the first quantifier.
1104
1105 $x =~ /(m{1,2})(.*)$/; # matches,
1106 # $1 = 'mm'
1107 # $2 = 'ing republic of Perl'
1108
1109Here, The earliest possible match is at the first C<'m'> in
1110C<programming>. C<m{1,2}> is the first quantifier, so it gets to match
1111a maximal C<mm>.
1112
1113 $x =~ /.*(m{1,2})(.*)$/; # matches,
1114 # $1 = 'm'
1115 # $2 = 'ing republic of Perl'
1116
1117Here, the regexp matches at the start of the string. The first
1118quantifier C<.*> grabs as much as possible, leaving just a single
1119C<'m'> for the second quantifier C<m{1,2}>.
1120
1121 $x =~ /(.?)(m{1,2})(.*)$/; # matches,
1122 # $1 = 'a'
1123 # $2 = 'mm'
1124 # $3 = 'ing republic of Perl'
1125
1126Here, C<.?> eats its maximal one character at the earliest possible
1127position in the string, C<'a'> in C<programming>, leaving C<m{1,2}>
1128the opportunity to match both C<m>'s. Finally,
1129
1130 "aXXXb" =~ /(X*)/; # matches with $1 = ''
1131
1132because it can match zero copies of C<'X'> at the beginning of the
1133string. If you definitely want to match at least one C<'X'>, use
1134C<X+>, not C<X*>.
1135
1136Sometimes greed is not good. At times, we would like quantifiers to
1137match a I<minimal> piece of string, rather than a maximal piece. For
7638d2dc
WL
1138this purpose, Larry Wall created the I<minimal match> or
1139I<non-greedy> quantifiers C<??>, C<*?>, C<+?>, and C<{}?>. These are
47f9c88b
GS
1140the usual quantifiers with a C<?> appended to them. They have the
1141following meanings:
1142
1143=over 4
1144
551e1d92
RB
1145=item *
1146
7638d2dc 1147C<a??> means: match 'a' 0 or 1 times. Try 0 first, then 1.
47f9c88b 1148
551e1d92
RB
1149=item *
1150
7638d2dc 1151C<a*?> means: match 'a' 0 or more times, i.e., any number of times,
47f9c88b
GS
1152but as few times as possible
1153
551e1d92
RB
1154=item *
1155
7638d2dc 1156C<a+?> means: match 'a' 1 or more times, i.e., at least once, but
47f9c88b
GS
1157as few times as possible
1158
551e1d92
RB
1159=item *
1160
7638d2dc 1161C<a{n,m}?> means: match at least C<n> times, not more than C<m>
47f9c88b
GS
1162times, as few times as possible
1163
551e1d92
RB
1164=item *
1165
7638d2dc 1166C<a{n,}?> means: match at least C<n> times, but as few times as
47f9c88b
GS
1167possible
1168
551e1d92
RB
1169=item *
1170
7638d2dc 1171C<a{n}?> means: match exactly C<n> times. Because we match exactly
47f9c88b
GS
1172C<n> times, C<a{n}?> is equivalent to C<a{n}> and is just there for
1173notational consistency.
1174
1175=back
1176
1177Let's look at the example above, but with minimal quantifiers:
1178
1179 $x = "The programming republic of Perl";
1180 $x =~ /^(.+?)(e|r)(.*)$/; # matches,
1181 # $1 = 'Th'
1182 # $2 = 'e'
1183 # $3 = ' programming republic of Perl'
1184
1185The minimal string that will allow both the start of the string C<^>
1186and the alternation to match is C<Th>, with the alternation C<e|r>
1187matching C<e>. The second quantifier C<.*> is free to gobble up the
1188rest of the string.
1189
1190 $x =~ /(m{1,2}?)(.*?)$/; # matches,
1191 # $1 = 'm'
1192 # $2 = 'ming republic of Perl'
1193
1194The first string position that this regexp can match is at the first
1195C<'m'> in C<programming>. At this position, the minimal C<m{1,2}?>
1196matches just one C<'m'>. Although the second quantifier C<.*?> would
1197prefer to match no characters, it is constrained by the end-of-string
1198anchor C<$> to match the rest of the string.
1199
1200 $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
1201 # $1 = 'The progra'
1202 # $2 = 'm'
1203 # $3 = 'ming republic of Perl'
1204
1205In this regexp, you might expect the first minimal quantifier C<.*?>
1206to match the empty string, because it is not constrained by a C<^>
1207anchor to match the beginning of the word. Principle 0 applies here,
1208however. Because it is possible for the whole regexp to match at the
1209start of the string, it I<will> match at the start of the string. Thus
1210the first quantifier has to match everything up to the first C<m>. The
1211second minimal quantifier matches just one C<m> and the third
1212quantifier matches the rest of the string.
1213
1214 $x =~ /(.??)(m{1,2})(.*)$/; # matches,
1215 # $1 = 'a'
1216 # $2 = 'mm'
1217 # $3 = 'ing republic of Perl'
1218
1219Just as in the previous regexp, the first quantifier C<.??> can match
1220earliest at position C<'a'>, so it does. The second quantifier is
1221greedy, so it matches C<mm>, and the third matches the rest of the
1222string.
1223
1224We can modify principle 3 above to take into account non-greedy
1225quantifiers:
1226
1227=over 4
1228
1229=item *
551e1d92 1230
47f9c88b
GS
1231Principle 3: If there are two or more elements in a regexp, the
1232leftmost greedy (non-greedy) quantifier, if any, will match as much
1233(little) of the string as possible while still allowing the whole
1234regexp to match. The next leftmost greedy (non-greedy) quantifier, if
1235any, will try to match as much (little) of the string remaining
1236available to it as possible, while still allowing the whole regexp to
1237match. And so on, until all the regexp elements are satisfied.
1238
1239=back
1240
1241Just like alternation, quantifiers are also susceptible to
1242backtracking. Here is a step-by-step analysis of the example
1243
1244 $x = "the cat in the hat";
1245 $x =~ /^(.*)(at)(.*)$/; # matches,
1246 # $1 = 'the cat in the h'
1247 # $2 = 'at'
1248 # $3 = '' (0 matches)
1249
1250=over 4
1251
551e1d92
RB
1252=item 0
1253
1254Start with the first letter in the string 't'.
47f9c88b 1255
551e1d92
RB
1256=item 1
1257
1258The first quantifier '.*' starts out by matching the whole
47f9c88b
GS
1259string 'the cat in the hat'.
1260
551e1d92
RB
1261=item 2
1262
1263'a' in the regexp element 'at' doesn't match the end of the
47f9c88b
GS
1264string. Backtrack one character.
1265
551e1d92
RB
1266=item 3
1267
1268'a' in the regexp element 'at' still doesn't match the last
47f9c88b
GS
1269letter of the string 't', so backtrack one more character.
1270
551e1d92
RB
1271=item 4
1272
1273Now we can match the 'a' and the 't'.
47f9c88b 1274
551e1d92
RB
1275=item 5
1276
1277Move on to the third element '.*'. Since we are at the end of
47f9c88b
GS
1278the string and '.*' can match 0 times, assign it the empty string.
1279
551e1d92
RB
1280=item 6
1281
1282We are done!
47f9c88b
GS
1283
1284=back
1285
1286Most of the time, all this moving forward and backtracking happens
7638d2dc 1287quickly and searching is fast. There are some pathological regexps,
47f9c88b
GS
1288however, whose execution time exponentially grows with the size of the
1289string. A typical structure that blows up in your face is of the form
1290
1291 /(a|b+)*/;
1292
1293The problem is the nested indeterminate quantifiers. There are many
1294different ways of partitioning a string of length n between the C<+>
1295and C<*>: one repetition with C<b+> of length n, two repetitions with
1296the first C<b+> length k and the second with length n-k, m repetitions
1297whose bits add up to length n, etc. In fact there are an exponential
7638d2dc 1298number of ways to partition a string as a function of its length. A
47f9c88b 1299regexp may get lucky and match early in the process, but if there is
7638d2dc 1300no match, Perl will try I<every> possibility before giving up. So be
47f9c88b 1301careful with nested C<*>'s, C<{n,m}>'s, and C<+>'s. The book
7638d2dc 1302I<Mastering Regular Expressions> by Jeffrey Friedl gives a wonderful
47f9c88b
GS
1303discussion of this and other efficiency issues.
1304
7638d2dc
WL
1305
1306=head2 Possessive quantifiers
1307
1308Backtracking during the relentless search for a match may be a waste
1309of time, particularly when the match is bound to fail. Consider
1310the simple pattern
1311
1312 /^\w+\s+\w+$/; # a word, spaces, a word
1313
1314Whenever this is applied to a string which doesn't quite meet the
1315pattern's expectations such as S<C<"abc ">> or S<C<"abc def ">>,
353c6505
DL
1316the regex engine will backtrack, approximately once for each character
1317in the string. But we know that there is no way around taking I<all>
1318of the initial word characters to match the first repetition, that I<all>
7638d2dc 1319spaces must be eaten by the middle part, and the same goes for the second
353c6505
DL
1320word.
1321
1322With the introduction of the I<possessive quantifiers> in Perl 5.10, we
1323have a way of instructing the regex engine not to backtrack, with the
1324usual quantifiers with a C<+> appended to them. This makes them greedy as
1325well as stingy; once they succeed they won't give anything back to permit
1326another solution. They have the following meanings:
7638d2dc
WL
1327
1328=over 4
1329
1330=item *
1331
353c6505
DL
1332C<a{n,m}+> means: match at least C<n> times, not more than C<m> times,
1333as many times as possible, and don't give anything up. C<a?+> is short
7638d2dc
WL
1334for C<a{0,1}+>
1335
1336=item *
1337
1338C<a{n,}+> means: match at least C<n> times, but as many times as possible,
353c6505 1339and don't give anything up. C<a*+> is short for C<a{0,}+> and C<a++> is
7638d2dc
WL
1340short for C<a{1,}+>.
1341
1342=item *
1343
1344C<a{n}+> means: match exactly C<n> times. It is just there for
1345notational consistency.
1346
1347=back
1348
353c6505
DL
1349These possessive quantifiers represent a special case of a more general
1350concept, the I<independent subexpression>, see below.
7638d2dc
WL
1351
1352As an example where a possessive quantifier is suitable we consider
1353matching a quoted string, as it appears in several programming languages.
1354The backslash is used as an escape character that indicates that the
1355next character is to be taken literally, as another character for the
1356string. Therefore, after the opening quote, we expect a (possibly
353c6505 1357empty) sequence of alternatives: either some character except an
7638d2dc
WL
1358unescaped quote or backslash or an escaped character.
1359
1360 /"(?:[^"\\]++|\\.)*+"/;
1361
1362
47f9c88b
GS
1363=head2 Building a regexp
1364
1365At this point, we have all the basic regexp concepts covered, so let's
1366give a more involved example of a regular expression. We will build a
1367regexp that matches numbers.
1368
1369The first task in building a regexp is to decide what we want to match
1370and what we want to exclude. In our case, we want to match both
1371integers and floating point numbers and we want to reject any string
1372that isn't a number.
1373
1374The next task is to break the problem down into smaller problems that
1375are easily converted into a regexp.
1376
1377The simplest case is integers. These consist of a sequence of digits,
1378with an optional sign in front. The digits we can represent with
1379C<\d+> and the sign can be matched with C<[+-]>. Thus the integer
1380regexp is
1381
1382 /[+-]?\d+/; # matches integers
1383
1384A floating point number potentially has a sign, an integral part, a
1385decimal point, a fractional part, and an exponent. One or more of these
1386parts is optional, so we need to check out the different
1387possibilities. Floating point numbers which are in proper form include
1388123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign out
1389front is completely optional and can be matched by C<[+-]?>. We can
1390see that if there is no exponent, floating point numbers must have a
1391decimal point, otherwise they are integers. We might be tempted to
1392model these with C<\d*\.\d*>, but this would also match just a single
1393decimal point, which is not a number. So the three cases of floating
7638d2dc 1394point number without exponent are
47f9c88b
GS
1395
1396 /[+-]?\d+\./; # 1., 321., etc.
1397 /[+-]?\.\d+/; # .1, .234, etc.
1398 /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
1399
1400These can be combined into a single regexp with a three-way alternation:
1401
1402 /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
1403
1404In this alternation, it is important to put C<'\d+\.\d+'> before
1405C<'\d+\.'>. If C<'\d+\.'> were first, the regexp would happily match that
1406and ignore the fractional part of the number.
1407
1408Now consider floating point numbers with exponents. The key
1409observation here is that I<both> integers and numbers with decimal
1410points are allowed in front of an exponent. Then exponents, like the
1411overall sign, are independent of whether we are matching numbers with
1412or without decimal points, and can be 'decoupled' from the
1413mantissa. The overall form of the regexp now becomes clear:
1414
1415 /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
1416
1417The exponent is an C<e> or C<E>, followed by an integer. So the
1418exponent regexp is
1419
1420 /[eE][+-]?\d+/; # exponent
1421
1422Putting all the parts together, we get a regexp that matches numbers:
1423
1424 /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
1425
1426Long regexps like this may impress your friends, but can be hard to
1427decipher. In complex situations like this, the C<//x> modifier for a
1428match is invaluable. It allows one to put nearly arbitrary whitespace
1429and comments into a regexp without affecting their meaning. Using it,
1430we can rewrite our 'extended' regexp in the more pleasing form
1431
1432 /^
1433 [+-]? # first, match an optional sign
1434 ( # then match integers or f.p. mantissas:
1435 \d+\.\d+ # mantissa of the form a.b
1436 |\d+\. # mantissa of the form a.
1437 |\.\d+ # mantissa of the form .b
1438 |\d+ # integer of the form a
1439 )
1440 ([eE][+-]?\d+)? # finally, optionally match an exponent
1441 $/x;
1442
1443If whitespace is mostly irrelevant, how does one include space
1444characters in an extended regexp? The answer is to backslash it
7638d2dc 1445S<C<'\ '>> or put it in a character class S<C<[ ]>>. The same thing
f5b885cd 1446goes for pound signs: use C<\#> or C<[#]>. For instance, Perl allows
7638d2dc 1447a space between the sign and the mantissa or integer, and we could add
47f9c88b
GS
1448this to our regexp as follows:
1449
1450 /^
1451 [+-]?\ * # first, match an optional sign *and space*
1452 ( # then match integers or f.p. mantissas:
1453 \d+\.\d+ # mantissa of the form a.b
1454 |\d+\. # mantissa of the form a.
1455 |\.\d+ # mantissa of the form .b
1456 |\d+ # integer of the form a
1457 )
1458 ([eE][+-]?\d+)? # finally, optionally match an exponent
1459 $/x;
1460
1461In this form, it is easier to see a way to simplify the
1462alternation. Alternatives 1, 2, and 4 all start with C<\d+>, so it
1463could be factored out:
1464
1465 /^
1466 [+-]?\ * # first, match an optional sign
1467 ( # then match integers or f.p. mantissas:
1468 \d+ # start out with a ...
1469 (
1470 \.\d* # mantissa of the form a.b or a.
1471 )? # ? takes care of integers of the form a
1472 |\.\d+ # mantissa of the form .b
1473 )
1474 ([eE][+-]?\d+)? # finally, optionally match an exponent
1475 $/x;
1476
1477or written in the compact form,
1478
1479 /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
1480
1481This is our final regexp. To recap, we built a regexp by
1482
1483=over 4
1484
551e1d92
RB
1485=item *
1486
1487specifying the task in detail,
47f9c88b 1488
551e1d92
RB
1489=item *
1490
1491breaking down the problem into smaller parts,
1492
1493=item *
47f9c88b 1494
551e1d92 1495translating the small parts into regexps,
47f9c88b 1496
551e1d92
RB
1497=item *
1498
1499combining the regexps,
1500
1501=item *
47f9c88b 1502
551e1d92 1503and optimizing the final combined regexp.
47f9c88b
GS
1504
1505=back
1506
1507These are also the typical steps involved in writing a computer
1508program. This makes perfect sense, because regular expressions are
7638d2dc 1509essentially programs written in a little computer language that specifies
47f9c88b
GS
1510patterns.
1511
1512=head2 Using regular expressions in Perl
1513
1514The last topic of Part 1 briefly covers how regexps are used in Perl
1515programs. Where do they fit into Perl syntax?
1516
1517We have already introduced the matching operator in its default
1518C</regexp/> and arbitrary delimiter C<m!regexp!> forms. We have used
1519the binding operator C<=~> and its negation C<!~> to test for string
1520matches. Associated with the matching operator, we have discussed the
1521single line C<//s>, multi-line C<//m>, case-insensitive C<//i> and
353c6505
DL
1522extended C<//x> modifiers. There are a few more things you might
1523want to know about matching operators.
47f9c88b 1524
7638d2dc
WL
1525=head3 Prohibiting substitution
1526
1527If you change C<$pattern> after the first substitution happens, Perl
47f9c88b
GS
1528will ignore it. If you don't want any substitutions at all, use the
1529special delimiter C<m''>:
1530
16e8b840 1531 @pattern = ('Seuss');
47f9c88b 1532 while (<>) {
16e8b840 1533 print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
47f9c88b
GS
1534 }
1535
353c6505 1536Similar to strings, C<m''> acts like apostrophes on a regexp; all other
7638d2dc 1537C<m> delimiters act like quotes. If the regexp evaluates to the empty string,
47f9c88b
GS
1538the regexp in the I<last successful match> is used instead. So we have
1539
1540 "dog" =~ /d/; # 'd' matches
1541 "dogbert =~ //; # this matches the 'd' regexp used before
1542
7638d2dc
WL
1543
1544=head3 Global matching
1545
7698aede 1546The final two modifiers we will discuss here,
5f67e4c9 1547C<//g> and C<//c>, concern multiple matches.
da75cd15 1548The modifier C<//g> stands for global matching and allows the
47f9c88b
GS
1549matching operator to match within a string as many times as possible.
1550In scalar context, successive invocations against a string will have
f5b885cd 1551C<//g> jump from match to match, keeping track of position in the
47f9c88b
GS
1552string as it goes along. You can get or set the position with the
1553C<pos()> function.
1554
1555The use of C<//g> is shown in the following example. Suppose we have
1556a string that consists of words separated by spaces. If we know how
1557many words there are in advance, we could extract the words using
1558groupings:
1559
1560 $x = "cat dog house"; # 3 words
1561 $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
1562 # $1 = 'cat'
1563 # $2 = 'dog'
1564 # $3 = 'house'
1565
1566But what if we had an indeterminate number of words? This is the sort
1567of task C<//g> was made for. To extract all words, form the simple
1568regexp C<(\w+)> and loop over all matches with C</(\w+)/g>:
1569
1570 while ($x =~ /(\w+)/g) {
1571 print "Word is $1, ends at position ", pos $x, "\n";
1572 }
1573
1574prints
1575
1576 Word is cat, ends at position 3
1577 Word is dog, ends at position 7
1578 Word is house, ends at position 13
1579
1580A failed match or changing the target string resets the position. If
1581you don't want the position reset after failure to match, add the
1582C<//c>, as in C</regexp/gc>. The current position in the string is
1583associated with the string, not the regexp. This means that different
1584strings have different positions and their respective positions can be
1585set or read independently.
1586
1587In list context, C<//g> returns a list of matched groupings, or if
1588there are no groupings, a list of matches to the whole regexp. So if
1589we wanted just the words, we could use
1590
1591 @words = ($x =~ /(\w+)/g); # matches,
5a0c7e9d
PJ
1592 # $words[0] = 'cat'
1593 # $words[1] = 'dog'
1594 # $words[2] = 'house'
47f9c88b
GS
1595
1596Closely associated with the C<//g> modifier is the C<\G> anchor. The
1597C<\G> anchor matches at the point where the previous C<//g> match left
1598off. C<\G> allows us to easily do context-sensitive matching:
1599
1600 $metric = 1; # use metric units
1601 ...
1602 $x = <FILE>; # read in measurement
1603 $x =~ /^([+-]?\d+)\s*/g; # get magnitude
1604 $weight = $1;
1605 if ($metric) { # error checking
1606 print "Units error!" unless $x =~ /\Gkg\./g;
1607 }
1608 else {
1609 print "Units error!" unless $x =~ /\Glbs\./g;
1610 }
1611 $x =~ /\G\s+(widget|sprocket)/g; # continue processing
1612
1613The combination of C<//g> and C<\G> allows us to process the string a
1614bit at a time and use arbitrary Perl logic to decide what to do next.
25cf8c22
HS
1615Currently, the C<\G> anchor is only fully supported when used to anchor
1616to the start of the pattern.
47f9c88b 1617
f5b885cd 1618C<\G> is also invaluable in processing fixed-length records with
47f9c88b
GS
1619regexps. Suppose we have a snippet of coding region DNA, encoded as
1620base pair letters C<ATCGTTGAAT...> and we want to find all the stop
1621codons C<TGA>. In a coding region, codons are 3-letter sequences, so
1622we can think of the DNA snippet as a sequence of 3-letter records. The
1623naive regexp
1624
1625 # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
1626 $dna = "ATCGTTGAATGCAAATGACATGAC";
1627 $dna =~ /TGA/;
1628
d1be9408 1629doesn't work; it may match a C<TGA>, but there is no guarantee that
47f9c88b 1630the match is aligned with codon boundaries, e.g., the substring
7638d2dc 1631S<C<GTT GAA>> gives a match. A better solution is
47f9c88b
GS
1632
1633 while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
1634 print "Got a TGA stop codon at position ", pos $dna, "\n";
1635 }
1636
1637which prints
1638
1639 Got a TGA stop codon at position 18
1640 Got a TGA stop codon at position 23
1641
1642Position 18 is good, but position 23 is bogus. What happened?
1643
1644The answer is that our regexp works well until we get past the last
1645real match. Then the regexp will fail to match a synchronized C<TGA>
1646and start stepping ahead one character position at a time, not what we
1647want. The solution is to use C<\G> to anchor the match to the codon
1648alignment:
1649
1650 while ($dna =~ /\G(\w\w\w)*?TGA/g) {
1651 print "Got a TGA stop codon at position ", pos $dna, "\n";
1652 }
1653
1654This prints
1655
1656 Got a TGA stop codon at position 18
1657
1658which is the correct answer. This example illustrates that it is
1659important not only to match what is desired, but to reject what is not
1660desired.
1661
0bd5a82d 1662(There are other regexp modifiers that are available, such as
615d795d 1663C<//o>, but their specialized uses are beyond the
0bd5a82d
KW
1664scope of this introduction. )
1665
7638d2dc 1666=head3 Search and replace
47f9c88b 1667
7638d2dc 1668Regular expressions also play a big role in I<search and replace>
47f9c88b
GS
1669operations in Perl. Search and replace is accomplished with the
1670C<s///> operator. The general form is
1671C<s/regexp/replacement/modifiers>, with everything we know about
1672regexps and modifiers applying in this case as well. The
f5b885cd 1673C<replacement> is a Perl double-quoted string that replaces in the
47f9c88b
GS
1674string whatever is matched with the C<regexp>. The operator C<=~> is
1675also used here to associate a string with C<s///>. If matching
7638d2dc 1676against C<$_>, the S<C<$_ =~>> can be dropped. If there is a match,
f5b885cd 1677C<s///> returns the number of substitutions made; otherwise it returns
47f9c88b
GS
1678false. Here are a few examples:
1679
1680 $x = "Time to feed the cat!";
1681 $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
1682 if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
1683 $more_insistent = 1;
1684 }
1685 $y = "'quoted words'";
1686 $y =~ s/^'(.*)'$/$1/; # strip single quotes,
1687 # $y contains "quoted words"
1688
1689In the last example, the whole string was matched, but only the part
1690inside the single quotes was grouped. With the C<s///> operator, the
f5b885cd 1691matched variables C<$1>, C<$2>, etc. are immediately available for use
47f9c88b
GS
1692in the replacement expression, so we use C<$1> to replace the quoted
1693string with just what was quoted. With the global modifier, C<s///g>
1694will search and replace all occurrences of the regexp in the string:
1695
1696 $x = "I batted 4 for 4";
1697 $x =~ s/4/four/; # doesn't do it all:
1698 # $x contains "I batted four for 4"
1699 $x = "I batted 4 for 4";
1700 $x =~ s/4/four/g; # does it all:
1701 # $x contains "I batted four for four"
1702
1703If you prefer 'regex' over 'regexp' in this tutorial, you could use
1704the following program to replace it:
1705
1706 % cat > simple_replace
1707 #!/usr/bin/perl
1708 $regexp = shift;
1709 $replacement = shift;
1710 while (<>) {
c2e2285d 1711 s/$regexp/$replacement/g;
47f9c88b
GS
1712 print;
1713 }
1714 ^D
1715
1716 % simple_replace regexp regex perlretut.pod
1717
1718In C<simple_replace> we used the C<s///g> modifier to replace all
c2e2285d
KW
1719occurrences of the regexp on each line. (Even though the regular
1720expression appears in a loop, Perl is smart enough to compile it
1721only once.) As with C<simple_grep>, both the
1722C<print> and the C<s/$regexp/$replacement/g> use C<$_> implicitly.
47f9c88b 1723
4f4d7508
DC
1724If you don't want C<s///> to change your original variable you can use
1725the non-destructive substitute modifier, C<s///r>. This changes the
d6b8a906
KW
1726behavior so that C<s///r> returns the final substituted string
1727(instead of the number of substitutions):
4f4d7508
DC
1728
1729 $x = "I like dogs.";
1730 $y = $x =~ s/dogs/cats/r;
1731 print "$x $y\n";
1732
1733That example will print "I like dogs. I like cats". Notice the original
f5b885cd 1734C<$x> variable has not been affected. The overall
4f4d7508
DC
1735result of the substitution is instead stored in C<$y>. If the
1736substitution doesn't affect anything then the original string is
1737returned:
1738
1739 $x = "I like dogs.";
1740 $y = $x =~ s/elephants/cougars/r;
1741 print "$x $y\n"; # prints "I like dogs. I like dogs."
1742
1743One other interesting thing that the C<s///r> flag allows is chaining
1744substitutions:
1745
1746 $x = "Cats are great.";
1747 print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~ s/Frogs/Hedgehogs/r, "\n";
1748 # prints "Hedgehogs are great."
1749
47f9c88b 1750A modifier available specifically to search and replace is the
f5b885cd
FC
1751C<s///e> evaluation modifier. C<s///e> treats the
1752replacement text as Perl code, rather than a double-quoted
1753string. The value that the code returns is substituted for the
47f9c88b
GS
1754matched substring. C<s///e> is useful if you need to do a bit of
1755computation in the process of replacing text. This example counts
1756character frequencies in a line:
1757
1758 $x = "Bill the cat";
1759 $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
1760 print "frequency of '$_' is $chars{$_}\n"
1761 foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
1762
1763This prints
1764
1765 frequency of ' ' is 2
1766 frequency of 't' is 2
1767 frequency of 'l' is 2
1768 frequency of 'B' is 1
1769 frequency of 'c' is 1
1770 frequency of 'e' is 1
1771 frequency of 'h' is 1
1772 frequency of 'i' is 1
1773 frequency of 'a' is 1
1774
1775As with the match C<m//> operator, C<s///> can use other delimiters,
1776such as C<s!!!> and C<s{}{}>, and even C<s{}//>. If single quotes are
f5b885cd
FC
1777used C<s'''>, then the regexp and replacement are
1778treated as single-quoted strings and there are no
1779variable substitutions. C<s///> in list context
47f9c88b
GS
1780returns the same thing as in scalar context, i.e., the number of
1781matches.
1782
7638d2dc 1783=head3 The split function
47f9c88b 1784
7638d2dc 1785The C<split()> function is another place where a regexp is used.
353c6505
DL
1786C<split /regexp/, string, limit> separates the C<string> operand into
1787a list of substrings and returns that list. The regexp must be designed
7638d2dc 1788to match whatever constitutes the separators for the desired substrings.
353c6505 1789The C<limit>, if present, constrains splitting into no more than C<limit>
7638d2dc 1790number of strings. For example, to split a string into words, use
47f9c88b
GS
1791
1792 $x = "Calvin and Hobbes";
1793 @words = split /\s+/, $x; # $word[0] = 'Calvin'
1794 # $word[1] = 'and'
1795 # $word[2] = 'Hobbes'
1796
1797If the empty regexp C<//> is used, the regexp always matches and
1798the string is split into individual characters. If the regexp has
7638d2dc 1799groupings, then the resulting list contains the matched substrings from the
47f9c88b
GS
1800groupings as well. For instance,
1801
1802 $x = "/usr/bin/perl";
1803 @dirs = split m!/!, $x; # $dirs[0] = ''
1804 # $dirs[1] = 'usr'
1805 # $dirs[2] = 'bin'
1806 # $dirs[3] = 'perl'
1807 @parts = split m!(/)!, $x; # $parts[0] = ''
1808 # $parts[1] = '/'
1809 # $parts[2] = 'usr'
1810 # $parts[3] = '/'
1811 # $parts[4] = 'bin'
1812 # $parts[5] = '/'
1813 # $parts[6] = 'perl'
1814
1815Since the first character of $x matched the regexp, C<split> prepended
1816an empty initial element to the list.
1817
1818If you have read this far, congratulations! You now have all the basic
1819tools needed to use regular expressions to solve a wide range of text
1820processing problems. If this is your first time through the tutorial,
f5b885cd 1821why not stop here and play around with regexps a while.... S<Part 2>
47f9c88b
GS
1822concerns the more esoteric aspects of regular expressions and those
1823concepts certainly aren't needed right at the start.
1824
1825=head1 Part 2: Power tools
1826
1827OK, you know the basics of regexps and you want to know more. If
1828matching regular expressions is analogous to a walk in the woods, then
1829the tools discussed in Part 1 are analogous to topo maps and a
1830compass, basic tools we use all the time. Most of the tools in part 2
da75cd15 1831are analogous to flare guns and satellite phones. They aren't used
47f9c88b
GS
1832too often on a hike, but when we are stuck, they can be invaluable.
1833
1834What follows are the more advanced, less used, or sometimes esoteric
7638d2dc 1835capabilities of Perl regexps. In Part 2, we will assume you are
7c579eed 1836comfortable with the basics and concentrate on the advanced features.
47f9c88b
GS
1837
1838=head2 More on characters, strings, and character classes
1839
1840There are a number of escape sequences and character classes that we
1841haven't covered yet.
1842
1843There are several escape sequences that convert characters or strings
7638d2dc 1844between upper and lower case, and they are also available within
353c6505 1845patterns. C<\l> and C<\u> convert the next character to lower or
7638d2dc 1846upper case, respectively:
47f9c88b
GS
1847
1848 $x = "perl";
1849 $string =~ /\u$x/; # matches 'Perl' in $string
1850 $x = "M(rs?|s)\\."; # note the double backslash
1851 $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
1852
7638d2dc
WL
1853A C<\L> or C<\U> indicates a lasting conversion of case, until
1854terminated by C<\E> or thrown over by another C<\U> or C<\L>:
47f9c88b
GS
1855
1856 $x = "This word is in lower case:\L SHOUT\E";
1857 $x =~ /shout/; # matches
1858 $x = "I STILL KEYPUNCH CARDS FOR MY 360"
1859 $x =~ /\Ukeypunch/; # matches punch card string
1860
1861If there is no C<\E>, case is converted until the end of the
1862string. The regexps C<\L\u$word> or C<\u\L$word> convert the first
1863character of C<$word> to uppercase and the rest of the characters to
1864lowercase.
1865
1866Control characters can be escaped with C<\c>, so that a control-Z
1867character would be matched with C<\cZ>. The escape sequence
1868C<\Q>...C<\E> quotes, or protects most non-alphabetic characters. For
1869instance,
1870
1871 $x = "\QThat !^*&%~& cat!";
1872 $x =~ /\Q!^*&%~&\E/; # check for rough language
1873
1874It does not protect C<$> or C<@>, so that variables can still be
1875substituted.
1876
8e71069f
FC
1877C<\Q>, C<\L>, C<\l>, C<\U>, C<\u> and C<\E> are actually part of
1878double-quotish syntax, and not part of regexp syntax proper. They will
7698aede 1879work if they appear in a regular expression embedded directly in a
8e71069f
FC
1880program, but not when contained in a string that is interpolated in a
1881pattern.
7c579eed 1882
13e5d9cd
BF
1883Perl regexps can handle more than just the
1884standard ASCII character set. Perl supports I<Unicode>, a standard
7638d2dc 1885for representing the alphabets from virtually all of the world's written
38a44b82 1886languages, and a host of symbols. Perl's text strings are Unicode strings, so
2575c402 1887they can contain characters with a value (codepoint or character number) higher
7c579eed 1888than 255.
47f9c88b
GS
1889
1890What does this mean for regexps? Well, regexp users don't need to know
7638d2dc 1891much about Perl's internal representation of strings. But they do need
2575c402
JW
1892to know 1) how to represent Unicode characters in a regexp and 2) that
1893a matching operation will treat the string to be searched as a sequence
1894of characters, not bytes. The answer to 1) is that Unicode characters
f0a2b745 1895greater than C<chr(255)> are represented using the C<\x{hex}> notation, because
5f67e4c9
KW
1896\x hex (without curly braces) doesn't go further than 255. (Starting in Perl
18975.14, if you're an octal fan, you can also use C<\o{oct}>.)
47f9c88b 1898
47f9c88b
GS
1899 /\x{263a}/; # match a Unicode smiley face :)
1900
7638d2dc 1901B<NOTE>: In Perl 5.6.0 it used to be that one needed to say C<use
72ff2908
JH
1902utf8> to use any Unicode features. This is no more the case: for
1903almost all Unicode processing, the explicit C<utf8> pragma is not
1904needed. (The only case where it matters is if your Perl script is in
1905Unicode and encoded in UTF-8, then an explicit C<use utf8> is needed.)
47f9c88b
GS
1906
1907Figuring out the hexadecimal sequence of a Unicode character you want
1908or deciphering someone else's hexadecimal Unicode regexp is about as
1909much fun as programming in machine code. So another way to specify
e526e8bb
KW
1910Unicode characters is to use the I<named character> escape
1911sequence C<\N{I<name>}>. I<name> is a name for the Unicode character, as
55eda711
JH
1912specified in the Unicode standard. For instance, if we wanted to
1913represent or match the astrological sign for the planet Mercury, we
1914could use
47f9c88b 1915
47f9c88b
GS
1916 $x = "abc\N{MERCURY}def";
1917 $x =~ /\N{MERCURY}/; # matches
1918
fbb93542 1919One can also use "short" names:
47f9c88b 1920
47f9c88b 1921 print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
47f9c88b
GS
1922 print "\N{greek:Sigma} is an upper-case sigma.\n";
1923
fbb93542
KW
1924You can also restrict names to a certain alphabet by specifying the
1925L<charnames> pragma:
1926
47f9c88b
GS
1927 use charnames qw(greek);
1928 print "\N{sigma} is Greek sigma\n";
1929
0bd42786
KW
1930An index of character names is available on-line from the Unicode
1931Consortium, L<http://www.unicode.org/charts/charindex.html>; explanatory
1932material with links to other resources at
1933L<http://www.unicode.org/standard/where>.
47f9c88b 1934
13e5d9cd
BF
1935The answer to requirement 2) is that a regexp (mostly)
1936uses Unicode characters. The "mostly" is for messy backward
615d795d
KW
1937compatibility reasons, but starting in Perl 5.14, any regex compiled in
1938the scope of a C<use feature 'unicode_strings'> (which is automatically
1939turned on within the scope of a C<use 5.012> or higher) will turn that
1940"mostly" into "always". If you want to handle Unicode properly, you
13e5d9cd 1941should ensure that C<'unicode_strings'> is turned on.
0bd5a82d
KW
1942Internally, this is encoded to bytes using either UTF-8 or a native 8
1943bit encoding, depending on the history of the string, but conceptually
1944it is a sequence of characters, not bytes. See L<perlunitut> for a
1945tutorial about that.
2575c402
JW
1946
1947Let us now discuss Unicode character classes. Just as with Unicode
1948characters, there are named Unicode character classes represented by the
1949C<\p{name}> escape sequence. Closely associated is the C<\P{name}>
1950character class, which is the negation of the C<\p{name}> class. For
1951example, to match lower and uppercase characters,
47f9c88b 1952
47f9c88b
GS
1953 $x = "BOB";
1954 $x =~ /^\p{IsUpper}/; # matches, uppercase char class
1955 $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
1956 $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
1957 $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
1958
5f67e4c9
KW
1959(The "Is" is optional.)
1960
86929931
JH
1961Here is the association between some Perl named classes and the
1962traditional Unicode classes:
47f9c88b 1963
86929931 1964 Perl class name Unicode class name or regular expression
47f9c88b 1965
f5868911
JH
1966 IsAlpha /^[LM]/
1967 IsAlnum /^[LMN]/
1968 IsASCII $code <= 127
1969 IsCntrl /^C/
1970 IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
47f9c88b 1971 IsDigit Nd
f5868911 1972 IsGraph /^([LMNPS]|Co)/
47f9c88b 1973 IsLower Ll
f5868911
JH
1974 IsPrint /^([LMNPS]|Co|Zs)/
1975 IsPunct /^P/
1976 IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
08ce8fc6 1977 IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
f5868911
JH
1978 IsUpper /^L[ut]/
1979 IsWord /^[LMN]/ || $code eq "005F"
47f9c88b
GS
1980 IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
1981
7c579eed
FC
1982You can also use the official Unicode class names with C<\p> and
1983C<\P>, like C<\p{L}> for Unicode 'letters', C<\p{Lu}> for uppercase
86929931
JH
1984letters, or C<\P{Nd}> for non-digits. If a C<name> is just one
1985letter, the braces can be dropped. For instance, C<\pM> is the
98f22ffc 1986character class of Unicode 'marks', for example accent marks.
32293815
JH
1987For the full list see L<perlunicode>.
1988
7c579eed 1989Unicode has also been separated into various sets of characters
7638d2dc
WL
1990which you can test with C<\p{...}> (in) and C<\P{...}> (not in).
1991To test whether a character is (or is not) an element of a script
353c6505 1992you would use the script name, for example C<\p{Latin}>, C<\p{Greek}>,
1cd08ccc 1993or C<\P{Katakana}>.
e1b711da
KW
1994
1995What we have described so far is the single form of the C<\p{...}> character
1996classes. There is also a compound form which you may run into. These
1997look like C<\p{name=value}> or C<\p{name:value}> (the equals sign and colon
1998can be used interchangeably). These are more general than the single form,
1999and in fact most of the single forms are just Perl-defined shortcuts for common
2000compound forms. For example, the script examples in the previous paragraph
2001could be written equivalently as C<\p{Script=Latin}>, C<\p{Script:Greek}>, and
2002C<\P{script=katakana}> (case is irrelevant between the C<{}> braces). You may
2003never have to use the compound forms, but sometimes it is necessary, and their
2004use can make your code easier to understand.
47f9c88b 2005
7638d2dc 2006C<\X> is an abbreviation for a character class that comprises
5f67e4c9 2007a Unicode I<extended grapheme cluster>. This represents a "logical character":
e1b711da
KW
2008what appears to be a single character, but may be represented internally by more
2009than one. As an example, using the Unicode full names, e.g., S<C<A + COMBINING
2010RING>> is a grapheme cluster with base character C<A> and combining character
2011S<C<COMBINING RING>>, which translates in Danish to A with the circle atop it,
2012as in the word Angstrom.
47f9c88b 2013
da75cd15 2014For the full and latest information about Unicode see the latest
e1b711da 2015Unicode standard, or the Unicode Consortium's website L<http://www.unicode.org>
5e42d7b4 2016
7c579eed 2017As if all those classes weren't enough, Perl also defines POSIX-style
47f9c88b 2018character classes. These have the form C<[:name:]>, with C<name> the
aaa51d5e
JF
2019name of the POSIX class. The POSIX classes are C<alpha>, C<alnum>,
2020C<ascii>, C<cntrl>, C<digit>, C<graph>, C<lower>, C<print>, C<punct>,
2021C<space>, C<upper>, and C<xdigit>, and two extensions, C<word> (a Perl
0bd5a82d
KW
2022extension to match C<\w>), and C<blank> (a GNU extension). The C<//a>
2023modifier restricts these to matching just in the ASCII range; otherwise
2024they can match the same as their corresponding Perl Unicode classes:
2025C<[:upper:]> is the same as C<\p{IsUpper}>, etc. (There are some
2026exceptions and gotchas with this; see L<perlrecharclass> for a full
2027discussion.) The C<[:digit:]>, C<[:word:]>, and
47f9c88b 2028C<[:space:]> correspond to the familiar C<\d>, C<\w>, and C<\s>
aaa51d5e 2029character classes. To negate a POSIX class, put a C<^> in front of
7c579eed
FC
2030the name, so that, e.g., C<[:^digit:]> corresponds to C<\D> and, under
2031Unicode, C<\P{IsDigit}>. The Unicode and POSIX character classes can
54c18d04
MK
2032be used just like C<\d>, with the exception that POSIX character
2033classes can only be used inside of a character class:
47f9c88b
GS
2034
2035 /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
54c18d04 2036 /^=item\s[[:digit:]]/; # match '=item',
47f9c88b 2037 # followed by a space and a digit
47f9c88b
GS
2038 /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
2039 /^=item\s\p{IsDigit}/; # match '=item',
2040 # followed by a space and a digit
2041
2042Whew! That is all the rest of the characters and character classes.
2043
2044=head2 Compiling and saving regular expressions
2045
c2e2285d
KW
2046In Part 1 we mentioned that Perl compiles a regexp into a compact
2047sequence of opcodes. Thus, a compiled regexp is a data structure
47f9c88b
GS
2048that can be stored once and used again and again. The regexp quote
2049C<qr//> does exactly that: C<qr/string/> compiles the C<string> as a
2050regexp and transforms the result into a form that can be assigned to a
2051variable:
2052
2053 $reg = qr/foo+bar?/; # reg contains a compiled regexp
2054
2055Then C<$reg> can be used as a regexp:
2056
2057 $x = "fooooba";
2058 $x =~ $reg; # matches, just like /foo+bar?/
2059 $x =~ /$reg/; # same thing, alternate form
2060
2061C<$reg> can also be interpolated into a larger regexp:
2062
2063 $x =~ /(abc)?$reg/; # still matches
2064
2065As with the matching operator, the regexp quote can use different
7638d2dc
WL
2066delimiters, e.g., C<qr!!>, C<qr{}> or C<qr~~>. Apostrophes
2067as delimiters (C<qr''>) inhibit any interpolation.
47f9c88b
GS
2068
2069Pre-compiled regexps are useful for creating dynamic matches that
2070don't need to be recompiled each time they are encountered. Using
7638d2dc
WL
2071pre-compiled regexps, we write a C<grep_step> program which greps
2072for a sequence of patterns, advancing to the next pattern as soon
2073as one has been satisfied.
47f9c88b 2074
7638d2dc 2075 % cat > grep_step
47f9c88b 2076 #!/usr/bin/perl
7638d2dc 2077 # grep_step - match <number> regexps, one after the other
47f9c88b
GS
2078 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2079
2080 $number = shift;
2081 $regexp[$_] = shift foreach (0..$number-1);
2082 @compiled = map qr/$_/, @regexp;
2083 while ($line = <>) {
7638d2dc
WL
2084 if ($line =~ /$compiled[0]/) {
2085 print $line;
2086 shift @compiled;
2087 last unless @compiled;
47f9c88b
GS
2088 }
2089 }
2090 ^D
2091
7638d2dc
WL
2092 % grep_step 3 shift print last grep_step
2093 $number = shift;
2094 print $line;
2095 last unless @compiled;
47f9c88b
GS
2096
2097Storing pre-compiled regexps in an array C<@compiled> allows us to
2098simply loop through the regexps without any recompilation, thus gaining
2099flexibility without sacrificing speed.
2100
7638d2dc
WL
2101
2102=head2 Composing regular expressions at runtime
2103
2104Backtracking is more efficient than repeated tries with different regular
2105expressions. If there are several regular expressions and a match with
353c6505 2106any of them is acceptable, then it is possible to combine them into a set
7638d2dc 2107of alternatives. If the individual expressions are input data, this
353c6505
DL
2108can be done by programming a join operation. We'll exploit this idea in
2109an improved version of the C<simple_grep> program: a program that matches
7638d2dc
WL
2110multiple patterns:
2111
2112 % cat > multi_grep
2113 #!/usr/bin/perl
2114 # multi_grep - match any of <number> regexps
2115 # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
2116
2117 $number = shift;
2118 $regexp[$_] = shift foreach (0..$number-1);
2119 $pattern = join '|', @regexp;
2120
2121 while ($line = <>) {
c2e2285d 2122 print $line if $line =~ /$pattern/;
7638d2dc
WL
2123 }
2124 ^D
2125
2126 % multi_grep 2 shift for multi_grep
2127 $number = shift;
2128 $regexp[$_] = shift foreach (0..$number-1);
2129
2130Sometimes it is advantageous to construct a pattern from the I<input>
2131that is to be analyzed and use the permissible values on the left
2132hand side of the matching operations. As an example for this somewhat
353c6505 2133paradoxical situation, let's assume that our input contains a command
7638d2dc 2134verb which should match one out of a set of available command verbs,
353c6505 2135with the additional twist that commands may be abbreviated as long as
7638d2dc
WL
2136the given string is unique. The program below demonstrates the basic
2137algorithm.
2138
2139 % cat > keymatch
2140 #!/usr/bin/perl
2141 $kwds = 'copy compare list print';
2142 while( $command = <> ){
2143 $command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
2144 if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
92a24ac3 2145 print "command: '@matches'\n";
7638d2dc
WL
2146 } elsif( @matches == 0 ){
2147 print "no such command: '$command'\n";
2148 } else {
2149 print "not unique: '$command' (could be one of: @matches)\n";
2150 }
2151 }
2152 ^D
2153
2154 % keymatch
2155 li
2156 command: 'list'
2157 co
2158 not unique: 'co' (could be one of: copy compare)
2159 printer
2160 no such command: 'printer'
2161
2162Rather than trying to match the input against the keywords, we match the
2163combined set of keywords against the input. The pattern matching
353c6505
DL
2164operation S<C<$kwds =~ /\b($command\w*)/g>> does several things at the
2165same time. It makes sure that the given command begins where a keyword
2166begins (C<\b>). It tolerates abbreviations due to the added C<\w*>. It
2167tells us the number of matches (C<scalar @matches>) and all the keywords
7638d2dc 2168that were actually matched. You could hardly ask for more.
7638d2dc 2169
47f9c88b
GS
2170=head2 Embedding comments and modifiers in a regular expression
2171
2172Starting with this section, we will be discussing Perl's set of
7638d2dc 2173I<extended patterns>. These are extensions to the traditional regular
47f9c88b
GS
2174expression syntax that provide powerful new tools for pattern
2175matching. We have already seen extensions in the form of the minimal
6b3ddc02
FC
2176matching constructs C<??>, C<*?>, C<+?>, C<{n,m}?>, and C<{n,}?>. Most
2177of the extensions below have the form C<(?char...)>, where the
47f9c88b
GS
2178C<char> is a character that determines the type of extension.
2179
2180The first extension is an embedded comment C<(?#text)>. This embeds a
2181comment into the regular expression without affecting its meaning. The
2182comment should not have any closing parentheses in the text. An
2183example is
2184
2185 /(?# Match an integer:)[+-]?\d+/;
2186
2187This style of commenting has been largely superseded by the raw,
2188freeform commenting that is allowed with the C<//x> modifier.
2189
5f67e4c9 2190Most modifiers, such as C<//i>, C<//m>, C<//s> and C<//x> (or any
24549070 2191combination thereof) can also be embedded in
47f9c88b
GS
2192a regexp using C<(?i)>, C<(?m)>, C<(?s)>, and C<(?x)>. For instance,
2193
2194 /(?i)yes/; # match 'yes' case insensitively
2195 /yes/i; # same thing
2196 /(?x)( # freeform version of an integer regexp
2197 [+-]? # match an optional sign
2198 \d+ # match a sequence of digits
2199 )
2200 /x;
2201
2202Embedded modifiers can have two important advantages over the usual
2203modifiers. Embedded modifiers allow a custom set of modifiers to
2204I<each> regexp pattern. This is great for matching an array of regexps
2205that must have different modifiers:
2206
2207 $pattern[0] = '(?i)doctor';
2208 $pattern[1] = 'Johnson';
2209 ...
2210 while (<>) {
2211 foreach $patt (@pattern) {
2212 print if /$patt/;
2213 }
2214 }
2215
24549070 2216The second advantage is that embedded modifiers (except C<//p>, which
7638d2dc 2217modifies the entire regexp) only affect the regexp
47f9c88b
GS
2218inside the group the embedded modifier is contained in. So grouping
2219can be used to localize the modifier's effects:
2220
2221 /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
2222
2223Embedded modifiers can also turn off any modifiers already present
2224by using, e.g., C<(?-i)>. Modifiers can also be combined into
2225a single expression, e.g., C<(?s-i)> turns on single line mode and
2226turns off case insensitivity.
2227
7638d2dc 2228Embedded modifiers may also be added to a non-capturing grouping.
47f9c88b
GS
2229C<(?i-m:regexp)> is a non-capturing grouping that matches C<regexp>
2230case insensitively and turns off multi-line mode.
2231
7638d2dc 2232
47f9c88b
GS
2233=head2 Looking ahead and looking behind
2234
2235This section concerns the lookahead and lookbehind assertions. First,
2236a little background.
2237
2238In Perl regular expressions, most regexp elements 'eat up' a certain
2239amount of string when they match. For instance, the regexp element
2240C<[abc}]> eats up one character of the string when it matches, in the
7638d2dc 2241sense that Perl moves to the next character position in the string
47f9c88b
GS
2242after the match. There are some elements, however, that don't eat up
2243characters (advance the character position) if they match. The examples
2244we have seen so far are the anchors. The anchor C<^> matches the
2245beginning of the line, but doesn't eat any characters. Similarly, the
7638d2dc 2246word boundary anchor C<\b> matches wherever a character matching C<\w>
353c6505 2247is next to a character that doesn't, but it doesn't eat up any
6b3ddc02
FC
2248characters itself. Anchors are examples of I<zero-width assertions>:
2249zero-width, because they consume
47f9c88b
GS
2250no characters, and assertions, because they test some property of the
2251string. In the context of our walk in the woods analogy to regexp
2252matching, most regexp elements move us along a trail, but anchors have
2253us stop a moment and check our surroundings. If the local environment
2254checks out, we can proceed forward. But if the local environment
2255doesn't satisfy us, we must backtrack.
2256
2257Checking the environment entails either looking ahead on the trail,
2258looking behind, or both. C<^> looks behind, to see that there are no
2259characters before. C<$> looks ahead, to see that there are no
2260characters after. C<\b> looks both ahead and behind, to see if the
7638d2dc 2261characters on either side differ in their "word-ness".
47f9c88b
GS
2262
2263The lookahead and lookbehind assertions are generalizations of the
2264anchor concept. Lookahead and lookbehind are zero-width assertions
2265that let us specify which characters we want to test for. The
2266lookahead assertion is denoted by C<(?=regexp)> and the lookbehind
a6b2f353 2267assertion is denoted by C<< (?<=fixed-regexp) >>. Some examples are
47f9c88b
GS
2268
2269 $x = "I catch the housecat 'Tom-cat' with catnip";
7638d2dc 2270 $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
47f9c88b
GS
2271 @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
2272 # $catwords[0] = 'catch'
2273 # $catwords[1] = 'catnip'
2274 $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
2275 $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
2276 # middle of $x
2277
a6b2f353 2278Note that the parentheses in C<(?=regexp)> and C<< (?<=regexp) >> are
47f9c88b
GS
2279non-capturing, since these are zero-width assertions. Thus in the
2280second regexp, the substrings captured are those of the whole regexp
a6b2f353
GS
2281itself. Lookahead C<(?=regexp)> can match arbitrary regexps, but
2282lookbehind C<< (?<=fixed-regexp) >> only works for regexps of fixed
2283width, i.e., a fixed number of characters long. Thus
2284C<< (?<=(ab|bc)) >> is fine, but C<< (?<=(ab)*) >> is not. The
2285negated versions of the lookahead and lookbehind assertions are
2286denoted by C<(?!regexp)> and C<< (?<!fixed-regexp) >> respectively.
2287They evaluate true if the regexps do I<not> match:
47f9c88b
GS
2288
2289 $x = "foobar";
2290 $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
2291 $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
2292 $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
2293
f14c76ed
RGS
2294The C<\C> is unsupported in lookbehind, because the already
2295treacherous definition of C<\C> would become even more so
2296when going backwards.
2297
7638d2dc
WL
2298Here is an example where a string containing blank-separated words,
2299numbers and single dashes is to be split into its components.
2300Using C</\s+/> alone won't work, because spaces are not required between
2301dashes, or a word or a dash. Additional places for a split are established
2302by looking ahead and behind:
47f9c88b 2303
7638d2dc
WL
2304 $str = "one two - --6-8";
2305 @toks = split / \s+ # a run of spaces
2306 | (?<=\S) (?=-) # any non-space followed by '-'
2307 | (?<=-) (?=\S) # a '-' followed by any non-space
2308 /x, $str; # @toks = qw(one two - - - 6 - 8)
47f9c88b 2309
7638d2dc
WL
2310
2311=head2 Using independent subexpressions to prevent backtracking
2312
2313I<Independent subexpressions> are regular expressions, in the
47f9c88b
GS
2314context of a larger regular expression, that function independently of
2315the larger regular expression. That is, they consume as much or as
2316little of the string as they wish without regard for the ability of
2317the larger regexp to match. Independent subexpressions are represented
2318by C<< (?>regexp) >>. We can illustrate their behavior by first
2319considering an ordinary regexp:
2320
2321 $x = "ab";
2322 $x =~ /a*ab/; # matches
2323
2324This obviously matches, but in the process of matching, the
2325subexpression C<a*> first grabbed the C<a>. Doing so, however,
2326wouldn't allow the whole regexp to match, so after backtracking, C<a*>
2327eventually gave back the C<a> and matched the empty string. Here, what
2328C<a*> matched was I<dependent> on what the rest of the regexp matched.
2329
2330Contrast that with an independent subexpression:
2331
2332 $x =~ /(?>a*)ab/; # doesn't match!
2333
2334The independent subexpression C<< (?>a*) >> doesn't care about the rest
2335of the regexp, so it sees an C<a> and grabs it. Then the rest of the
2336regexp C<ab> cannot match. Because C<< (?>a*) >> is independent, there
da75cd15 2337is no backtracking and the independent subexpression does not give
47f9c88b
GS
2338up its C<a>. Thus the match of the regexp as a whole fails. A similar
2339behavior occurs with completely independent regexps:
2340
2341 $x = "ab";
2342 $x =~ /a*/g; # matches, eats an 'a'
2343 $x =~ /\Gab/g; # doesn't match, no 'a' available
2344
2345Here C<//g> and C<\G> create a 'tag team' handoff of the string from
2346one regexp to the other. Regexps with an independent subexpression are
2347much like this, with a handoff of the string to the independent
2348subexpression, and a handoff of the string back to the enclosing
2349regexp.
2350
2351The ability of an independent subexpression to prevent backtracking
2352can be quite useful. Suppose we want to match a non-empty string
2353enclosed in parentheses up to two levels deep. Then the following
2354regexp matches:
2355
2356 $x = "abc(de(fg)h"; # unbalanced parentheses
2357 $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
2358
2359The regexp matches an open parenthesis, one or more copies of an
2360alternation, and a close parenthesis. The alternation is two-way, with
2361the first alternative C<[^()]+> matching a substring with no
2362parentheses and the second alternative C<\([^()]*\)> matching a
2363substring delimited by parentheses. The problem with this regexp is
2364that it is pathological: it has nested indeterminate quantifiers
07698885 2365of the form C<(a+|b)+>. We discussed in Part 1 how nested quantifiers
47f9c88b
GS
2366like this could take an exponentially long time to execute if there
2367was no match possible. To prevent the exponential blowup, we need to
2368prevent useless backtracking at some point. This can be done by
2369enclosing the inner quantifier as an independent subexpression:
2370
2371 $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
2372
2373Here, C<< (?>[^()]+) >> breaks the degeneracy of string partitioning
2374by gobbling up as much of the string as possible and keeping it. Then
2375match failures fail much more quickly.
2376
7638d2dc 2377
47f9c88b
GS
2378=head2 Conditional expressions
2379
7638d2dc 2380A I<conditional expression> is a form of if-then-else statement
47f9c88b
GS
2381that allows one to choose which patterns are to be matched, based on
2382some condition. There are two types of conditional expression:
2383C<(?(condition)yes-regexp)> and
2384C<(?(condition)yes-regexp|no-regexp)>. C<(?(condition)yes-regexp)> is
7638d2dc 2385like an S<C<'if () {}'>> statement in Perl. If the C<condition> is true,
47f9c88b 2386the C<yes-regexp> will be matched. If the C<condition> is false, the
7638d2dc
WL
2387C<yes-regexp> will be skipped and Perl will move onto the next regexp
2388element. The second form is like an S<C<'if () {} else {}'>> statement
47f9c88b
GS
2389in Perl. If the C<condition> is true, the C<yes-regexp> will be
2390matched, otherwise the C<no-regexp> will be matched.
2391
7638d2dc 2392The C<condition> can have several forms. The first form is simply an
47f9c88b 2393integer in parentheses C<(integer)>. It is true if the corresponding
7638d2dc 2394backreference C<\integer> matched earlier in the regexp. The same
c27a5cfe 2395thing can be done with a name associated with a capture group, written
7638d2dc 2396as C<< (<name>) >> or C<< ('name') >>. The second form is a bare
6b3ddc02 2397zero-width assertion C<(?...)>, either a lookahead, a lookbehind, or a
7638d2dc
WL
2398code assertion (discussed in the next section). The third set of forms
2399provides tests that return true if the expression is executed within
2400a recursion (C<(R)>) or is being called from some capturing group,
2401referenced either by number (C<(R1)>, C<(R2)>,...) or by name
2402(C<(R&name)>).
2403
2404The integer or name form of the C<condition> allows us to choose,
2405with more flexibility, what to match based on what matched earlier in the
2406regexp. This searches for words of the form C<"$x$x"> or C<"$x$y$y$x">:
47f9c88b 2407
d8b950dc 2408 % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
47f9c88b
GS
2409 beriberi
2410 coco
2411 couscous
2412 deed
2413 ...
2414 toot
2415 toto
2416 tutu
2417
2418The lookbehind C<condition> allows, along with backreferences,
2419an earlier part of the match to influence a later part of the
2420match. For instance,
2421
2422 /[ATGC]+(?(?<=AA)G|C)$/;
2423
2424matches a DNA sequence such that it either ends in C<AAG>, or some
2425other base pair combination and C<C>. Note that the form is
a6b2f353
GS
2426C<< (?(?<=AA)G|C) >> and not C<< (?((?<=AA))G|C) >>; for the
2427lookahead, lookbehind or code assertions, the parentheses around the
2428conditional are not needed.
47f9c88b 2429
7638d2dc
WL
2430
2431=head2 Defining named patterns
2432
2433Some regular expressions use identical subpatterns in several places.
2434Starting with Perl 5.10, it is possible to define named subpatterns in
2435a section of the pattern so that they can be called up by name
2436anywhere in the pattern. This syntactic pattern for this definition
2437group is C<< (?(DEFINE)(?<name>pattern)...) >>. An insertion
2438of a named pattern is written as C<(?&name)>.
2439
2440The example below illustrates this feature using the pattern for
2441floating point numbers that was presented earlier on. The three
2442subpatterns that are used more than once are the optional sign, the
2443digit sequence for an integer and the decimal fraction. The DEFINE
2444group at the end of the pattern contains their definition. Notice
2445that the decimal fraction pattern is the first place where we can
2446reuse the integer pattern.
2447
353c6505 2448 /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
7638d2dc
WL
2449 (?: [eE](?&osg)(?&int) )?
2450 $
2451 (?(DEFINE)
2452 (?<osg>[-+]?) # optional sign
2453 (?<int>\d++) # integer
2454 (?<dec>\.(?&int)) # decimal fraction
2455 )/x
2456
2457
2458=head2 Recursive patterns
2459
2460This feature (introduced in Perl 5.10) significantly extends the
2461power of Perl's pattern matching. By referring to some other
2462capture group anywhere in the pattern with the construct
353c6505 2463C<(?group-ref)>, the I<pattern> within the referenced group is used
7638d2dc
WL
2464as an independent subpattern in place of the group reference itself.
2465Because the group reference may be contained I<within> the group it
2466refers to, it is now possible to apply pattern matching to tasks that
2467hitherto required a recursive parser.
2468
2469To illustrate this feature, we'll design a pattern that matches if
2470a string contains a palindrome. (This is a word or a sentence that,
2471while ignoring spaces, interpunctuation and case, reads the same backwards
2472as forwards. We begin by observing that the empty string or a string
2473containing just one word character is a palindrome. Otherwise it must
2474have a word character up front and the same at its end, with another
2475palindrome in between.
2476
fd2b7f55 2477 /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
7638d2dc 2478
e57a4e52 2479Adding C<\W*> at either end to eliminate what is to be ignored, we already
7638d2dc
WL
2480have the full pattern:
2481
2482 my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
2483 for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
2484 print "'$s' is a palindrome\n" if $s =~ /$pp/;
2485 }
2486
2487In C<(?...)> both absolute and relative backreferences may be used.
2488The entire pattern can be reinserted with C<(?R)> or C<(?0)>.
c27a5cfe
KW
2489If you prefer to name your groups, you can use C<(?&name)> to
2490recurse into that group.
7638d2dc
WL
2491
2492
47f9c88b
GS
2493=head2 A bit of magic: executing Perl code in a regular expression
2494
2495Normally, regexps are a part of Perl expressions.
7638d2dc 2496I<Code evaluation> expressions turn that around by allowing
da75cd15 2497arbitrary Perl code to be a part of a regexp. A code evaluation
7638d2dc 2498expression is denoted C<(?{code})>, with I<code> a string of Perl
47f9c88b
GS
2499statements.
2500
353c6505 2501Be warned that this feature is considered experimental, and may be
7638d2dc
WL
2502changed without notice.
2503
47f9c88b
GS
2504Code expressions are zero-width assertions, and the value they return
2505depends on their environment. There are two possibilities: either the
2506code expression is used as a conditional in a conditional expression
2507C<(?(condition)...)>, or it is not. If the code expression is a
2508conditional, the code is evaluated and the result (i.e., the result of
2509the last statement) is used to determine truth or falsehood. If the
2510code expression is not used as a conditional, the assertion always
2511evaluates true and the result is put into the special variable
2512C<$^R>. The variable C<$^R> can then be used in code expressions later
2513in the regexp. Here are some silly examples:
2514
2515 $x = "abcdef";
2516 $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
2517 # prints 'Hi Mom!'
2518 $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
2519 # no 'Hi Mom!'
745e1e41
DC
2520
2521Pay careful attention to the next example:
2522
47f9c88b
GS
2523 $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
2524 # no 'Hi Mom!'
745e1e41
DC
2525 # but why not?
2526
2527At first glance, you'd think that it shouldn't print, because obviously
2528the C<ddd> isn't going to match the target string. But look at this
2529example:
2530
87167316
RGS
2531 $x =~ /abc(?{print "Hi Mom!";})[dD]dd/; # doesn't match,
2532 # but _does_ print
745e1e41
DC
2533
2534Hmm. What happened here? If you've been following along, you know that
ac036724 2535the above pattern should be effectively (almost) the same as the last one;
2536enclosing the C<d> in a character class isn't going to change what it
745e1e41
DC
2537matches. So why does the first not print while the second one does?
2538
7638d2dc 2539The answer lies in the optimizations the regex engine makes. In the first
745e1e41
DC
2540case, all the engine sees are plain old characters (aside from the
2541C<?{}> construct). It's smart enough to realize that the string 'ddd'
2542doesn't occur in our target string before actually running the pattern
2543through. But in the second case, we've tricked it into thinking that our
87167316 2544pattern is more complicated. It takes a look, sees our
745e1e41
DC
2545character class, and decides that it will have to actually run the
2546pattern to determine whether or not it matches, and in the process of
2547running it hits the print statement before it discovers that we don't
2548have a match.
2549
2550To take a closer look at how the engine does optimizations, see the
2551section L<"Pragmas and debugging"> below.
2552
2553More fun with C<?{}>:
2554
47f9c88b
GS
2555 $x =~ /(?{print "Hi Mom!";})/; # matches,
2556 # prints 'Hi Mom!'
2557 $x =~ /(?{$c = 1;})(?{print "$c";})/; # matches,
2558 # prints '1'
2559 $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
2560 # prints '1'
2561
2562The bit of magic mentioned in the section title occurs when the regexp
2563backtracks in the process of searching for a match. If the regexp
2564backtracks over a code expression and if the variables used within are
2565localized using C<local>, the changes in the variables produced by the
2566code expression are undone! Thus, if we wanted to count how many times
2567a character got matched inside a group, we could use, e.g.,
2568
2569 $x = "aaaa";
2570 $count = 0; # initialize 'a' count
2571 $c = "bob"; # test if $c gets clobbered
2572 $x =~ /(?{local $c = 0;}) # initialize count
2573 ( a # match 'a'
2574 (?{local $c = $c + 1;}) # increment count
2575 )* # do this any number of times,
2576 aa # but match 'aa' at the end
2577 (?{$count = $c;}) # copy local $c var into $count
2578 /x;
2579 print "'a' count is $count, \$c variable is '$c'\n";
2580
2581This prints
2582
2583 'a' count is 2, $c variable is 'bob'
2584
7638d2dc
WL
2585If we replace the S<C< (?{local $c = $c + 1;})>> with
2586S<C< (?{$c = $c + 1;})>>, the variable changes are I<not> undone
47f9c88b
GS
2587during backtracking, and we get
2588
2589 'a' count is 4, $c variable is 'bob'
2590
2591Note that only localized variable changes are undone. Other side
2592effects of code expression execution are permanent. Thus
2593
2594 $x = "aaaa";
2595 $x =~ /(a(?{print "Yow\n";}))*aa/;
2596
2597produces
2598
2599 Yow
2600 Yow
2601 Yow
2602 Yow
2603
2604The result C<$^R> is automatically localized, so that it will behave
2605properly in the presence of backtracking.
2606
7638d2dc
WL
2607This example uses a code expression in a conditional to match a
2608definite article, either 'the' in English or 'der|die|das' in German:
47f9c88b 2609
47f9c88b
GS
2610 $lang = 'DE'; # use German
2611 ...
2612 $text = "das";
2613 print "matched\n"
2614 if $text =~ /(?(?{
2615 $lang eq 'EN'; # is the language English?
2616 })
2617 the | # if so, then match 'the'
7638d2dc 2618 (der|die|das) # else, match 'der|die|das'
47f9c88b
GS
2619 )
2620 /xi;
2621
2622Note that the syntax here is C<(?(?{...})yes-regexp|no-regexp)>, not
2623C<(?((?{...}))yes-regexp|no-regexp)>. In other words, in the case of a
2624code expression, we don't need the extra parentheses around the
2625conditional.
2626
e128ab2c
DM
2627If you try to use code expressions where the code text is contained within
2628an interpolated variable, rather than appearing literally in the pattern,
2629Perl may surprise you:
a6b2f353
GS
2630
2631 $bar = 5;
2632 $pat = '(?{ 1 })';
2633 /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
e128ab2c 2634 /foo(?{ 1 })$bar/; # compiles ok, $bar interpolated
a6b2f353
GS
2635 /foo${pat}bar/; # compile error!
2636
2637 $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
2638 /foo${pat}bar/; # compiles ok
2639
e128ab2c
DM
2640If a regexp has a variable that interpolates a code expression, Perl
2641treats the regexp as an error. If the code expression is precompiled into
2642a variable, however, interpolating is ok. The question is, why is this an
2643error?
a6b2f353
GS
2644
2645The reason is that variable interpolation and code expressions
2646together pose a security risk. The combination is dangerous because
2647many programmers who write search engines often take user input and
2648plug it directly into a regexp:
47f9c88b
GS
2649
2650 $regexp = <>; # read user-supplied regexp
2651 $chomp $regexp; # get rid of possible newline
2652 $text =~ /$regexp/; # search $text for the $regexp
2653
a6b2f353
GS
2654If the C<$regexp> variable contains a code expression, the user could
2655then execute arbitrary Perl code. For instance, some joker could
7638d2dc
WL
2656search for S<C<system('rm -rf *');>> to erase your files. In this
2657sense, the combination of interpolation and code expressions I<taints>
47f9c88b 2658your regexp. So by default, using both interpolation and code
a6b2f353
GS
2659expressions in the same regexp is not allowed. If you're not
2660concerned about malicious users, it is possible to bypass this
7638d2dc 2661security check by invoking S<C<use re 'eval'>>:
a6b2f353
GS
2662
2663 use re 'eval'; # throw caution out the door
2664 $bar = 5;
2665 $pat = '(?{ 1 })';
a6b2f353 2666 /foo${pat}bar/; # compiles ok
47f9c88b 2667
7638d2dc 2668Another form of code expression is the I<pattern code expression>.
47f9c88b
GS
2669The pattern code expression is like a regular code expression, except
2670that the result of the code evaluation is treated as a regular
2671expression and matched immediately. A simple example is
2672
2673 $length = 5;
2674 $char = 'a';
2675 $x = 'aaaaabb';
2676 $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
2677
2678
2679This final example contains both ordinary and pattern code
7638d2dc 2680expressions. It detects whether a binary string C<1101010010001...> has a
47f9c88b
GS
2681Fibonacci spacing 0,1,1,2,3,5,... of the C<1>'s:
2682
47f9c88b 2683 $x = "1101010010001000001";
7638d2dc 2684 $z0 = ''; $z1 = '0'; # initial conditions
47f9c88b
GS
2685 print "It is a Fibonacci sequence\n"
2686 if $x =~ /^1 # match an initial '1'
7638d2dc
WL
2687 (?:
2688 ((??{ $z0 })) # match some '0'
2689 1 # and then a '1'
2690 (?{ $z0 = $z1; $z1 .= $^N; })
47f9c88b
GS
2691 )+ # repeat as needed
2692 $ # that is all there is
2693 /x;
7638d2dc 2694 printf "Largest sequence matched was %d\n", length($z1)-length($z0);
47f9c88b 2695
7638d2dc
WL
2696Remember that C<$^N> is set to whatever was matched by the last
2697completed capture group. This prints
47f9c88b
GS
2698
2699 It is a Fibonacci sequence
2700 Largest sequence matched was 5
2701
2702Ha! Try that with your garden variety regexp package...
2703
7638d2dc 2704Note that the variables C<$z0> and C<$z1> are not substituted when the
47f9c88b 2705regexp is compiled, as happens for ordinary variables outside a code
e128ab2c
DM
2706expression. Rather, the whole code block is parsed as perl code at the
2707same time as perl is compiling the code containing the literal regexp
2708pattern.
47f9c88b
GS
2709
2710The regexp without the C<//x> modifier is
2711
7638d2dc
WL
2712 /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
2713
2714which shows that spaces are still possible in the code parts. Nevertheless,
353c6505 2715when working with code and conditional expressions, the extended form of
7638d2dc
WL
2716regexps is almost necessary in creating and debugging regexps.
2717
2718
2719=head2 Backtracking control verbs
2720
2721Perl 5.10 introduced a number of control verbs intended to provide
2722detailed control over the backtracking process, by directly influencing
2723the regexp engine and by providing monitoring techniques. As all
2724the features in this group are experimental and subject to change or
2725removal in a future version of Perl, the interested reader is
2726referred to L<perlre/"Special Backtracking Control Verbs"> for a
2727detailed description.
2728
2729Below is just one example, illustrating the control verb C<(*FAIL)>,
2730which may be abbreviated as C<(*F)>. If this is inserted in a regexp
6b3ddc02
FC
2731it will cause it to fail, just as it would at some
2732mismatch between the pattern and the string. Processing
2733of the regexp continues as it would after any "normal"
353c6505
DL
2734failure, so that, for instance, the next position in the string or another
2735alternative will be tried. As failing to match doesn't preserve capture
c27a5cfe 2736groups or produce results, it may be necessary to use this in
7638d2dc
WL
2737combination with embedded code.
2738
2739 %count = ();
b539c2c9 2740 "supercalifragilisticexpialidocious" =~
c2e2285d 2741 /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
7638d2dc
WL
2742 printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
2743
353c6505
DL
2744The pattern begins with a class matching a subset of letters. Whenever
2745this matches, a statement like C<$count{'a'}++;> is executed, incrementing
2746the letter's counter. Then C<(*FAIL)> does what it says, and
6b3ddc02
FC
2747the regexp engine proceeds according to the book: as long as the end of
2748the string hasn't been reached, the position is advanced before looking
7638d2dc 2749for another vowel. Thus, match or no match makes no difference, and the
e1020413 2750regexp engine proceeds until the entire string has been inspected.
7638d2dc
WL
2751(It's remarkable that an alternative solution using something like
2752
b539c2c9 2753 $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
7638d2dc
WL
2754 printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
2755
2756is considerably slower.)
47f9c88b 2757
47f9c88b
GS
2758
2759=head2 Pragmas and debugging
2760
2761Speaking of debugging, there are several pragmas available to control
2762and debug regexps in Perl. We have already encountered one pragma in
7638d2dc 2763the previous section, S<C<use re 'eval';>>, that allows variable
a6b2f353
GS
2764interpolation and code expressions to coexist in a regexp. The other
2765pragmas are
47f9c88b
GS
2766
2767 use re 'taint';
2768 $tainted = <>;
2769 @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
2770
2771The C<taint> pragma causes any substrings from a match with a tainted
2772variable to be tainted as well. This is not normally the case, as
2773regexps are often used to extract the safe bits from a tainted
2774variable. Use C<taint> when you are not extracting safe bits, but are
2775performing some other processing. Both C<taint> and C<eval> pragmas
a6b2f353 2776are lexically scoped, which means they are in effect only until
47f9c88b
GS
2777the end of the block enclosing the pragmas.
2778
511eb430
FC
2779 use re '/m'; # or any other flags
2780 $multiline_string =~ /^foo/; # /m is implied
2781
9fa86798
FC
2782The C<re '/flags'> pragma (introduced in Perl
27835.14) turns on the given regular expression flags
3fd67154
KW
2784until the end of the lexical scope. See
2785L<re/"'E<sol>flags' mode"> for more
511eb430
FC
2786detail.
2787
47f9c88b
GS
2788 use re 'debug';
2789 /^(.*)$/s; # output debugging info
2790
2791 use re 'debugcolor';
2792 /^(.*)$/s; # output debugging info in living color
2793
2794The global C<debug> and C<debugcolor> pragmas allow one to get
2795detailed debugging info about regexp compilation and
2796execution. C<debugcolor> is the same as debug, except the debugging
2797information is displayed in color on terminals that can display
2798termcap color sequences. Here is example output:
2799
2800 % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
ccf3535a 2801 Compiling REx 'a*b+c'
47f9c88b
GS
2802 size 9 first at 1
2803 1: STAR(4)
2804 2: EXACT <a>(0)
2805 4: PLUS(7)
2806 5: EXACT <b>(0)
2807 7: EXACT <c>(9)
2808 9: END(0)
ccf3535a
JK
2809 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2810 Guessing start of match, REx 'a*b+c' against 'abc'...
2811 Found floating substr 'bc' at offset 1...
47f9c88b 2812 Guessed: match at offset 0
ccf3535a 2813 Matching REx 'a*b+c' against 'abc'
47f9c88b
GS
2814 Setting an EVAL scope, savestack=3
2815 0 <> <abc> | 1: STAR
2816 EXACT <a> can match 1 times out of 32767...
2817 Setting an EVAL scope, savestack=3
2818 1 <a> <bc> | 4: PLUS
2819 EXACT <b> can match 1 times out of 32767...
2820 Setting an EVAL scope, savestack=3
2821 2 <ab> <c> | 7: EXACT <c>
2822 3 <abc> <> | 9: END
2823 Match successful!
ccf3535a 2824 Freeing REx: 'a*b+c'
47f9c88b
GS
2825
2826If you have gotten this far into the tutorial, you can probably guess
2827what the different parts of the debugging output tell you. The first
2828part
2829
ccf3535a 2830 Compiling REx 'a*b+c'
47f9c88b
GS
2831 size 9 first at 1
2832 1: STAR(4)
2833 2: EXACT <a>(0)
2834 4: PLUS(7)
2835 5: EXACT <b>(0)
2836 7: EXACT <c>(9)
2837 9: END(0)
2838
2839describes the compilation stage. C<STAR(4)> means that there is a
2840starred object, in this case C<'a'>, and if it matches, goto line 4,
2841i.e., C<PLUS(7)>. The middle lines describe some heuristics and
2842optimizations performed before a match:
2843
ccf3535a
JK
2844 floating 'bc' at 0..2147483647 (checking floating) minlen 2
2845 Guessing start of match, REx 'a*b+c' against 'abc'...
2846 Found floating substr 'bc' at offset 1...
47f9c88b
GS
2847 Guessed: match at offset 0
2848
2849Then the match is executed and the remaining lines describe the
2850process:
2851
ccf3535a 2852 Matching REx 'a*b+c' against 'abc'
47f9c88b
GS
2853 Setting an EVAL scope, savestack=3
2854 0 <> <abc> | 1: STAR
2855 EXACT <a> can match 1 times out of 32767...
2856 Setting an EVAL scope, savestack=3
2857 1 <a> <bc> | 4: PLUS
2858 EXACT <b> can match 1 times out of 32767...
2859 Setting an EVAL scope, savestack=3
2860 2 <ab> <c> | 7: EXACT <c>
2861 3 <abc> <> | 9: END
2862 Match successful!
ccf3535a 2863 Freeing REx: 'a*b+c'
47f9c88b 2864
7638d2dc 2865Each step is of the form S<C<< n <x> <y> >>>, with C<< <x> >> the
47f9c88b 2866part of the string matched and C<< <y> >> the part not yet
7638d2dc 2867matched. The S<C<< | 1: STAR >>> says that Perl is at line number 1
39b6ec1a 2868in the compilation list above. See
d9f2b251 2869L<perldebguts/"Debugging Regular Expressions"> for much more detail.
47f9c88b
GS
2870
2871An alternative method of debugging regexps is to embed C<print>
2872statements within the regexp. This provides a blow-by-blow account of
2873the backtracking in an alternation:
2874
2875 "that this" =~ m@(?{print "Start at position ", pos, "\n";})
2876 t(?{print "t1\n";})
2877 h(?{print "h1\n";})
2878 i(?{print "i1\n";})
2879 s(?{print "s1\n";})
2880 |
2881 t(?{print "t2\n";})
2882 h(?{print "h2\n";})
2883 a(?{print "a2\n";})
2884 t(?{print "t2\n";})
2885 (?{print "Done at position ", pos, "\n";})
2886 @x;
2887
2888prints
2889
2890 Start at position 0
2891 t1
2892 h1
2893 t2
2894 h2
2895 a2
2896 t2
2897 Done at position 4
2898
2899=head1 BUGS
2900
2901Code expressions, conditional expressions, and independent expressions
7638d2dc 2902are I<experimental>. Don't use them in production code. Yet.
47f9c88b
GS
2903
2904=head1 SEE ALSO
2905
7638d2dc 2906This is just a tutorial. For the full story on Perl regular
47f9c88b
GS
2907expressions, see the L<perlre> regular expressions reference page.
2908
2909For more information on the matching C<m//> and substitution C<s///>
2910operators, see L<perlop/"Regexp Quote-Like Operators">. For
2911information on the C<split> operation, see L<perlfunc/split>.
2912
2913For an excellent all-around resource on the care and feeding of
2914regular expressions, see the book I<Mastering Regular Expressions> by
2915Jeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3).
2916
2917=head1 AUTHOR AND COPYRIGHT
2918
2919Copyright (c) 2000 Mark Kvale
2920All rights reserved.
2921
2922This document may be distributed under the same terms as Perl itself.
2923
2924=head2 Acknowledgments
2925
2926The inspiration for the stop codon DNA example came from the ZIP
2927code example in chapter 7 of I<Mastering Regular Expressions>.
2928
a6b2f353
GS
2929The author would like to thank Jeff Pinyan, Andrew Johnson, Peter
2930Haworth, Ronald J Kimball, and Joe Smith for all their helpful
2931comments.
47f9c88b
GS
2932
2933=cut
a6b2f353 2934